ID: 1074382574

View in Genome Browser
Species Human (GRCh38)
Location 10:112992427-112992449
Sequence CTGTGGGCGTTGGGATTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 133}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382561_1074382574 22 Left 1074382561 10:112992382-112992404 CCCAGACCCGACAGAGAGGCCTT No data
Right 1074382574 10:112992427-112992449 CTGTGGGCGTTGGGATTCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 133
1074382568_1074382574 3 Left 1074382568 10:112992401-112992423 CCTTTGTTGGAGCTGGAGGTGAG No data
Right 1074382574 10:112992427-112992449 CTGTGGGCGTTGGGATTCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 133
1074382565_1074382574 15 Left 1074382565 10:112992389-112992411 CCGACAGAGAGGCCTTTGTTGGA No data
Right 1074382574 10:112992427-112992449 CTGTGGGCGTTGGGATTCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 133
1074382563_1074382574 16 Left 1074382563 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG No data
Right 1074382574 10:112992427-112992449 CTGTGGGCGTTGGGATTCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 133
1074382562_1074382574 21 Left 1074382562 10:112992383-112992405 CCAGACCCGACAGAGAGGCCTTT No data
Right 1074382574 10:112992427-112992449 CTGTGGGCGTTGGGATTCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382574 Original CRISPR CTGTGGGCGTTGGGATTCCT GGG Intronic