ID: 1074382765

View in Genome Browser
Species Human (GRCh38)
Location 10:112993669-112993691
Sequence TGAATCCCCTCTACAAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074382761_1074382765 10 Left 1074382761 10:112993636-112993658 CCCAGCAAGCACTTAAAACACAG 0: 1
1: 0
2: 5
3: 22
4: 240
Right 1074382765 10:112993669-112993691 TGAATCCCCTCTACAAGAGAGGG No data
1074382762_1074382765 9 Left 1074382762 10:112993637-112993659 CCAGCAAGCACTTAAAACACAGT 0: 1
1: 0
2: 1
3: 21
4: 213
Right 1074382765 10:112993669-112993691 TGAATCCCCTCTACAAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074382765 Original CRISPR TGAATCCCCTCTACAAGAGA GGG Intronic
No off target data available for this crispr