ID: 1074383335

View in Genome Browser
Species Human (GRCh38)
Location 10:112997616-112997638
Sequence AAGAGTGACCAGGGACCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074383326_1074383335 -5 Left 1074383326 10:112997598-112997620 CCAACCTTCTCCCCCAGGAAGAG 0: 1
1: 0
2: 9
3: 38
4: 335
Right 1074383335 10:112997616-112997638 AAGAGTGACCAGGGACCTGAGGG No data
1074383324_1074383335 17 Left 1074383324 10:112997576-112997598 CCTTTTCGTGAAAGGGTTGACAC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1074383335 10:112997616-112997638 AAGAGTGACCAGGGACCTGAGGG No data
1074383327_1074383335 -9 Left 1074383327 10:112997602-112997624 CCTTCTCCCCCAGGAAGAGTGAC 0: 1
1: 0
2: 2
3: 25
4: 241
Right 1074383335 10:112997616-112997638 AAGAGTGACCAGGGACCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074383335 Original CRISPR AAGAGTGACCAGGGACCTGA GGG Intronic
No off target data available for this crispr