ID: 1074385946

View in Genome Browser
Species Human (GRCh38)
Location 10:113016833-113016855
Sequence CAGGATCTGGTGGGCAGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 320}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074385946_1074385951 -7 Left 1074385946 10:113016833-113016855 CCTCCGCTGCCCACCAGATCCTG 0: 1
1: 0
2: 2
3: 32
4: 320
Right 1074385951 10:113016849-113016871 GATCCTGACAGCATCCCACGCGG No data
1074385946_1074385956 15 Left 1074385946 10:113016833-113016855 CCTCCGCTGCCCACCAGATCCTG 0: 1
1: 0
2: 2
3: 32
4: 320
Right 1074385956 10:113016871-113016893 GGAGCACTCTCGTGTGCCCCTGG No data
1074385946_1074385952 -6 Left 1074385946 10:113016833-113016855 CCTCCGCTGCCCACCAGATCCTG 0: 1
1: 0
2: 2
3: 32
4: 320
Right 1074385952 10:113016850-113016872 ATCCTGACAGCATCCCACGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074385946 Original CRISPR CAGGATCTGGTGGGCAGCGG AGG (reversed) Intronic
901168111 1:7234297-7234319 CAGCATCTGGGTGGAAGCGGAGG - Intronic
901399263 1:9004874-9004896 CAGGACCTGGAGGGCAGAGCAGG + Exonic
902399811 1:16151714-16151736 CAGGATGTGAGGGGCAGGGGTGG - Intronic
902538652 1:17136692-17136714 CAGGATCTGGTAGGCAGCAGGGG + Intergenic
902563729 1:17295948-17295970 CAGGCTCTGGTGGTCAGAGAAGG - Intergenic
902586208 1:17439837-17439859 CAGGCTCGGGTGGGCAGGGCAGG - Intergenic
902923162 1:19679267-19679289 GCGGCCCTGGTGGGCAGCGGGGG - Exonic
902952692 1:19899017-19899039 CAGGAGCTGGAGGGCAGCCTGGG - Intronic
903009181 1:20318346-20318368 CAGGATCTAGTGGGGGTCGGAGG - Intronic
903229651 1:21914018-21914040 CAGGATCTGGTGTGTAGAGAGGG + Intronic
904463883 1:30696770-30696792 TAAGATCTGGTGGGGAGTGGGGG - Intergenic
904464378 1:30699135-30699157 TAAGATCTGGTGGGGAGTGGGGG - Intergenic
905296166 1:36955855-36955877 CTGGCCCTGGTGGCCAGCGGGGG - Intronic
905352391 1:37356639-37356661 CAGAGTATGGTGGGCAACGGGGG + Intergenic
905381009 1:37561638-37561660 CAGGGTCTGGTAGGCAGCGATGG - Exonic
905479258 1:38249962-38249984 AAGGGTCTGGTGGGCGGCAGAGG + Intergenic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
906324426 1:44835960-44835982 CAGAATCTGGTGGAAATCGGTGG + Intronic
906496555 1:46308378-46308400 AAGGAATTGGTGGGCAGCGTAGG + Intronic
907665654 1:56432040-56432062 CAGGAACTTGTGGGTAGAGGAGG + Intergenic
912560506 1:110548203-110548225 CAGGATCTGGTGAGCCATGGAGG + Intergenic
912804471 1:112744277-112744299 CAGGGCCTGGTGGCCCGCGGTGG + Intergenic
912869454 1:113290740-113290762 CAGGGTCTGTTGGGGAGTGGAGG - Intergenic
913029981 1:114892223-114892245 CTGGCTCTGGTGGGCAGGGGTGG + Intronic
913518502 1:119624314-119624336 GAAGAACTGGTGGGCAGAGGGGG - Intronic
914911361 1:151790253-151790275 AAGGATGTGGGGCGCAGCGGGGG - Intronic
915543492 1:156583039-156583061 CAGGCTCTGTGGGGCAGCGGTGG + Exonic
919849903 1:201665594-201665616 CAGGAGGTGGTGGGCAGTGGGGG - Intronic
919860518 1:201736910-201736932 CAGGGAGTGGGGGGCAGCGGAGG - Intronic
921382749 1:214542036-214542058 CAGGGTATGGTGAGCAGGGGTGG - Intronic
922565690 1:226600344-226600366 CAGGATATGGAGGGCTGGGGAGG + Intronic
1063962079 10:11315034-11315056 CAGGAGCGGGTGGGCTGTGGAGG - Intronic
1065189215 10:23195119-23195141 CCGGCTCTGGCGGGCAGGGGAGG - Intergenic
1066015739 10:31241761-31241783 CATGATCTTGTGGGCAGGTGAGG + Intergenic
1067790872 10:49286809-49286831 CAGGCTGTGGGGGGCACCGGAGG + Intergenic
1068232907 10:54194127-54194149 AAGCATCTGGTGGGAAGAGGTGG + Intronic
1068870236 10:61935550-61935572 CAGGAGCTGGTGGGGAGTGGAGG + Intronic
1069535367 10:69249006-69249028 CAGGATCTGGGGGTCGGGGGGGG - Intronic
1069551947 10:69370264-69370286 CAGGTACTGGTGGTCAGGGGAGG + Intronic
1069624607 10:69860085-69860107 CTGTACCTGGTGGGCAGCGTGGG + Intronic
1069708919 10:70476848-70476870 CAGCATCTGCTGGGCAGGGAGGG + Intergenic
1070159295 10:73856058-73856080 CAGAATCTGATGGGGTGCGGTGG - Intronic
1070753560 10:78977772-78977794 CAGGGTCTGGAGGGCAGGAGAGG - Intergenic
1071299407 10:84245180-84245202 CAGAACCTGGGGTGCAGCGGGGG + Intronic
1071383291 10:85093390-85093412 CAGCAACTGGTGGGGAGGGGAGG - Intergenic
1071430628 10:85603663-85603685 CAGGACCTGGTGCTCAGCAGAGG + Intronic
1072607934 10:96999535-96999557 GGGGTTCTGGTGGGCAACGGGGG - Exonic
1072731576 10:97850218-97850240 CGGGAGCAGGTGGGCGGCGGCGG - Exonic
1072790305 10:98312882-98312904 CAGGGTGTGGTGGACTGCGGAGG - Intergenic
1073558746 10:104479494-104479516 CAGGAGTGGGTGGGCAGGGGTGG + Intergenic
1074385946 10:113016833-113016855 CAGGATCTGGTGGGCAGCGGAGG - Intronic
1074431641 10:113399763-113399785 AAGGCTCTGGTTGGCAGGGGTGG + Intergenic
1076690185 10:132219785-132219807 CATGATGTGGGGGGCAGGGGTGG - Intronic
1076726626 10:132416921-132416943 CAGGAGCTGGGGGGCGGTGGAGG + Intronic
1076881166 10:133239852-133239874 CAGGCTGGGGTGGGCAGGGGTGG + Intronic
1076946335 10:133653659-133653681 CAGAATAAGGCGGGCAGCGGGGG + Intergenic
1077158738 11:1103100-1103122 CAGGGTCTGGTTGGGAGCAGTGG + Intergenic
1079129301 11:17738191-17738213 CAGGAGCTGGTAGGCAGCCCAGG - Intronic
1079320082 11:19444556-19444578 GAGGAGCAGGTGGGCAGTGGGGG - Intronic
1080278283 11:30527440-30527462 CAGGAGCCGGTGGGCAAGGGTGG + Intronic
1081246874 11:40777973-40777995 CAAGATCTGGCCGGGAGCGGTGG - Intronic
1081453785 11:43200707-43200729 CAGGGTCTGGTGGGTAGGTGAGG - Intergenic
1081603182 11:44509493-44509515 CAGGGGCTGGTGGGGAGGGGAGG + Intergenic
1081613398 11:44576871-44576893 CAGGATCCCGTGGGCAGTTGAGG + Intronic
1083186692 11:61021876-61021898 CAGGATGTGGTTGGCAGTGTTGG + Intergenic
1088877706 11:113949579-113949601 CAGGCCATGATGGGCAGCGGGGG + Intergenic
1088955042 11:114609194-114609216 CAGTATCTGGTGGGTAATGGTGG - Intergenic
1089288956 11:117426293-117426315 CAATATCTGGTGTGCAGGGGAGG + Intergenic
1090305657 11:125688890-125688912 CAGGTTAGGGTGGGGAGCGGTGG - Intergenic
1090467233 11:126945327-126945349 CAGGCTGTGGGGGGCAGAGGTGG + Intronic
1090660044 11:128875670-128875692 CAGGATCTGCTGTGCTGGGGAGG + Intergenic
1090777643 11:129979390-129979412 CAGCCTCTGGTGGGCTGCAGAGG + Intronic
1091046137 11:132327595-132327617 CTGGCTCTAGTGGGCAGAGGAGG - Intronic
1094494187 12:30979262-30979284 CAGAAGCTGGTGGGAGGCGGTGG - Intronic
1094597033 12:31875040-31875062 TGGCATCTGGTGGGCAGGGGAGG - Intergenic
1095849501 12:46786986-46787008 CAGGATATAGTTGGCAGCAGTGG - Intronic
1097468595 12:59959067-59959089 CAGGACCTGTTGGGGAGCCGGGG + Intergenic
1100318917 12:93471589-93471611 CAGGATTTGGTGGCCAGGTGCGG - Intronic
1102674915 12:114650875-114650897 CAGAATCTGGTCGGTCGCGGTGG - Intergenic
1103843662 12:123886354-123886376 CAGGAGCTGCTGGGGAGGGGAGG + Intronic
1104897823 12:132172869-132172891 CTGGACCTGGGGGGCAGTGGGGG + Intergenic
1105407209 13:20142510-20142532 CGGGAGCTGGGGGGCAGGGGCGG + Exonic
1106024185 13:25941235-25941257 CAGGATCTGGGAGGCATAGGAGG - Intronic
1106368610 13:29108699-29108721 CAGCATTTGGTGGGCAGGGGAGG + Intronic
1106410118 13:29505761-29505783 CAGCATGTGGTGGGCAGGGGCGG - Exonic
1112953938 13:105036467-105036489 TAGGAGCTGGTGGGCAGGGGAGG - Intergenic
1113388708 13:109874881-109874903 CAGGATCAGAGGGGCAGGGGCGG + Intergenic
1121489629 14:94348705-94348727 AAGGATCTGGTGGGGCGCAGGGG - Intergenic
1122056145 14:99099516-99099538 CAGGCCCTGGAGGGCAGGGGTGG + Intergenic
1122234980 14:100326283-100326305 CATCACCTGCTGGGCAGCGGAGG - Intronic
1122314898 14:100820182-100820204 CAGGCAGTGGTAGGCAGCGGTGG + Intergenic
1122322881 14:100866191-100866213 CAGGATGGGGTGGGCAGGGCAGG + Intergenic
1122501305 14:102201966-102201988 AAGGCTCTGGTGGGAAGCAGTGG - Intronic
1122848530 14:104513872-104513894 CAGGGGCTGGTGGGCACCTGAGG + Intronic
1122992605 14:105244511-105244533 GAGGAAGTGGTGGGCAGCGGCGG + Intronic
1123023860 14:105414617-105414639 CGGCACCTGGTGGGCAGAGGCGG + Intronic
1123439873 15:20282494-20282516 CAGGCGCTGATGGGCAGAGGTGG + Intergenic
1124250419 15:28103488-28103510 CAGGAGCTAGTGGGGAGCGGAGG + Intergenic
1125969423 15:43899883-43899905 CAGAATCCCGTGGGCAACGGTGG + Intronic
1126141738 15:45444926-45444948 CAGGGTCTGGTGGGCTGAGAAGG - Intronic
1126203353 15:46014784-46014806 CAGGCTATGGTGGGCAGAGCAGG + Intergenic
1126510481 15:49466338-49466360 CAGGAACTGGTAGGCAGAGCAGG + Intronic
1127144082 15:56007187-56007209 CAGGATCCGGGCGGCGGCGGCGG + Intergenic
1128251708 15:66168321-66168343 CAGGAGCTGGAGGGCATCAGAGG - Intronic
1128288007 15:66454595-66454617 AAGGATCTGGCTGGGAGCGGTGG + Intronic
1128529151 15:68432084-68432106 CTGGGTCCGGTGTGCAGCGGCGG + Exonic
1128668224 15:69554130-69554152 CAGGAACAAGTGGGCAGTGGGGG + Intergenic
1129357935 15:75004887-75004909 CAGGACCTGGTTGGGCGCGGTGG + Intronic
1129504253 15:76067920-76067942 CAGGCTCTGGTGGGGAGAGCTGG - Intronic
1130676923 15:85961023-85961045 AAGGAGCTGTGGGGCAGCGGGGG + Intergenic
1131095976 15:89654689-89654711 CACTATCTGTTGGGCAGCGTGGG - Intronic
1132362102 15:101225030-101225052 CAGGATGAGTTGGGGAGCGGTGG - Intronic
1132505302 16:305126-305148 CAGGATTTGGAGGACAGGGGAGG + Intronic
1132540488 16:506353-506375 CAGCCTCTTGTGGGCAGAGGAGG + Intronic
1132581150 16:685201-685223 CAGGATCTGGGTGCCAGGGGCGG + Intronic
1132634627 16:937588-937610 CAGCATCTGCAGGGCATCGGGGG - Intronic
1132659075 16:1053572-1053594 CAGGCTGGGGTGGGCAGCTGGGG + Intergenic
1132697186 16:1207258-1207280 CAGGATCTGGGGGATAGCAGGGG - Exonic
1132853228 16:2034060-2034082 CAGGATCTGGTGGGTGTCTGGGG - Intronic
1132897757 16:2237021-2237043 CAGGATCTGGGGAGGAGCGGCGG - Exonic
1133296900 16:4758338-4758360 CAGGAGCTGGTGGACAGAGCTGG + Intronic
1134100902 16:11450679-11450701 AAGGACCTGGTGGTCAGCGTGGG - Exonic
1135856430 16:26015342-26015364 CAGAATCTGGTGGGGAATGGGGG + Intronic
1136233309 16:28900465-28900487 CAGGAAGTGGTGGGGAGGGGTGG - Intronic
1136379774 16:29887811-29887833 CAGGATGCTGTGGGCAGAGGAGG + Exonic
1136476484 16:30516907-30516929 CAGGGTCTGGGGGGCAGCTGGGG + Intronic
1136503983 16:30690796-30690818 CTGGAGCTGGAGGGCAGTGGTGG - Intergenic
1136654138 16:31699679-31699701 CAGAAGCAGGTGGGCAGCAGTGG + Intergenic
1137463466 16:48686861-48686883 CAGGATAGGGTGGGCAATGGAGG + Intergenic
1139911765 16:70401614-70401636 CATGACGTGGTGGGCAGCTGAGG - Intronic
1140479917 16:75256942-75256964 GAGGACCTGGTGGTCAGCAGCGG - Intronic
1140690416 16:77478175-77478197 CAGGTGCTGGCCGGCAGCGGTGG - Intergenic
1141166679 16:81665496-81665518 CAGGGTCTGATGAGCAGCTGTGG + Intronic
1141425853 16:83943951-83943973 CAGGATTTGGTGGACAGAGGTGG + Intronic
1141761062 16:86029004-86029026 CAGTGTCTGGGGGGCAGTGGAGG + Intergenic
1141829049 16:86499264-86499286 CAGGGGCAGGTGGGCAGCGGTGG + Intergenic
1141971531 16:87487405-87487427 CAGGGCCTGGTGGGCAGGGGCGG - Intronic
1142292524 16:89199562-89199584 CCAAACCTGGTGGGCAGCGGGGG + Exonic
1143149300 17:4797567-4797589 CAGGTGCTTGTGGGCAGGGGAGG + Exonic
1143723459 17:8829840-8829862 CAGGATGGGGAGGGCAGAGGAGG - Intronic
1144675430 17:17158625-17158647 CAGGAGCGGGTGGGCGGCGTGGG + Exonic
1145793613 17:27643348-27643370 CAGGCTCTGGTGAGCAGTGCAGG - Intronic
1145808424 17:27750904-27750926 CAGGCTCTGGTGAGCAGTGCAGG - Intergenic
1146062469 17:29614410-29614432 CAGCAGCTGGTGGGAAGGGGTGG - Exonic
1146302460 17:31700194-31700216 CATGATCTGCTGGGCACTGGGGG + Intergenic
1146342463 17:32032871-32032893 CAGAATCTGGTGGCCAGGAGCGG + Intronic
1146656101 17:34636161-34636183 CAAGGTCTGTTGGGCAGCTGTGG - Exonic
1147588027 17:41664150-41664172 CAGGAGCCTGTGGGCAGGGGAGG - Intergenic
1147743241 17:42680393-42680415 CTGGAGCAGGTGGGCAGAGGTGG + Exonic
1148128607 17:45249130-45249152 CAGGATTTTGTGGGAAGGGGAGG + Intergenic
1148282734 17:46361582-46361604 CAGAAACTGGAGGGCGGCGGTGG - Intronic
1148304952 17:46579507-46579529 CAGAAACTGGAGGGCGGCGGTGG - Intronic
1148722005 17:49760560-49760582 AAGGTTCTGGTGGTCAGAGGAGG + Intronic
1150346361 17:64407430-64407452 CAGGAGCTGGCGGGGTGCGGTGG + Intronic
1150571766 17:66393125-66393147 CAGGCTATGGTGGGAAGTGGTGG + Intronic
1150728030 17:67667188-67667210 CAGGATCTGCTGTCCAGCTGTGG - Intronic
1151349305 17:73522299-73522321 CAGGATGAGGTGGGCAGCAGAGG - Intronic
1152216047 17:79033147-79033169 AAGGTTCTGCTGGGCAGCGCTGG - Intronic
1152334628 17:79693446-79693468 CAGCATCTGCTGTGCAGAGGTGG - Intergenic
1152361696 17:79835895-79835917 CAGGACCTCTTGGGCAGAGGAGG - Intronic
1152667197 17:81577971-81577993 CCGGATGGGGTGGGCAGGGGAGG - Intronic
1152854760 17:82658443-82658465 CGGCATCTGGAGGGCAGAGGTGG + Intronic
1154157547 18:11955827-11955849 CAGGATCTGGGGGCCTGGGGAGG + Intergenic
1156298843 18:35817942-35817964 CAGAATCTGGGGGGAAGCTGAGG - Intergenic
1157483862 18:48073421-48073443 CGGGAGGTGGTGGGCAGGGGTGG + Intronic
1157820815 18:50767267-50767289 CAGGCTGTGGTGGGCAGGGTGGG - Intergenic
1160187047 18:76684135-76684157 CAGGACCTGGAGAGCAGGGGAGG + Intergenic
1160272166 18:77397145-77397167 CAGGCTCTGGTGGGCACTGGGGG + Intergenic
1160682855 19:419849-419871 CAGGAGCTGCTCGGCAGCCGTGG - Intronic
1161940615 19:7401212-7401234 CAGGGTGTGGTGGCCAGTGGTGG + Intronic
1162913288 19:13861548-13861570 CAGACTCTGGTGGGGTGCGGAGG + Intergenic
1162948879 19:14058959-14058981 CAGGAACTGGGGGGCAGAGGGGG + Intronic
1163060874 19:14760720-14760742 CAGGCTATGGTGGGAAGTGGGGG + Intronic
1163328577 19:16621378-16621400 CAGTCTCTGTTGGGCAGCAGAGG - Intronic
1163370408 19:16897989-16898011 GGGGATCTGTGGGGCAGCGGCGG + Exonic
1164051250 19:21586985-21587007 CAGTGGCTGGTGGGCAGTGGGGG + Intergenic
1164324309 19:24178647-24178669 CAGAAAGTGGTGGGCAGCGTTGG + Intergenic
1164365877 19:27581078-27581100 CTGTATCTGGTGGTCAGAGGAGG + Intergenic
1165433628 19:35785349-35785371 CATGGGCTGGTGGGCAGCGATGG + Intronic
1165492371 19:36131896-36131918 CAGGATCGGGTGGGGCGCAGTGG + Intergenic
1165849103 19:38838862-38838884 CAGGCTCGGGAGGGCAGCAGAGG - Intronic
1166253420 19:41586305-41586327 CAGGAGGTGGTGAGCAGAGGAGG + Intronic
1166531519 19:43546206-43546228 CTGGATCTGGAGGGCAGTTGAGG - Intronic
1166785356 19:45363951-45363973 AAGGGACTGGGGGGCAGCGGGGG + Intronic
925380466 2:3421886-3421908 CAGAAACTGGAGGGCAGCAGTGG + Exonic
925410794 2:3638762-3638784 CAGGATCTGGAGGGAGGCGTGGG + Intronic
928332401 2:30367783-30367805 CAGAATCTGGGGTGCAGAGGGGG - Intergenic
930341028 2:50114847-50114869 CAGGATCTAGTGGGGAGAGAGGG + Intronic
930468963 2:51789514-51789536 CAGGATGTCATGGGCAGCCGGGG + Intergenic
931855989 2:66302143-66302165 CATGCTTTGGTGGGCAGTGGGGG + Intergenic
932780604 2:74556331-74556353 CAGGGCCTGAGGGGCAGCGGCGG - Exonic
932856650 2:75241233-75241255 CCTGATCTGGTGGTCAGCTGGGG - Intergenic
934113528 2:88764423-88764445 CAGGGCCTGGTTGACAGCGGTGG - Intergenic
934682686 2:96296540-96296562 CAGGAGATGGTGGGCAGCTTTGG - Exonic
934926924 2:98388616-98388638 CAGCCTCCGGTGGGCAGCCGGGG + Intronic
936153189 2:110032758-110032780 CAGGACATGGCGGGCAGCTGTGG + Intergenic
936191492 2:110338657-110338679 CAGGACATGGCGGGCAGCTGTGG - Intergenic
937243536 2:120477664-120477686 CAGGAGGTGATGGGCAGAGGTGG - Intergenic
938307792 2:130266683-130266705 CAGGAGCTGGAGGGCAGCCAGGG - Intergenic
938447545 2:131390158-131390180 CAGGAGCTGGAGGGCAGCCAGGG + Intergenic
939391678 2:141576437-141576459 CAGGGCCTGTTGGGGAGCGGGGG + Intronic
942141583 2:172982813-172982835 TAATATCTGGTGGGCAGTGGTGG + Intronic
943470915 2:188292535-188292557 CAGGAACTGGAGGGAGGCGGTGG + Intronic
944893674 2:204142752-204142774 ACGGATCTTGGGGGCAGCGGTGG - Intergenic
946416335 2:219541826-219541848 CAGGTACAGGTGGGCGGCGGAGG + Exonic
947928631 2:233943263-233943285 CAGGGTCTGTTGGGGAGTGGGGG - Intronic
948479416 2:238240565-238240587 CAGGGTCCATTGGGCAGCGGTGG + Intronic
1168954462 20:1825176-1825198 CAGGAGCTGTTGGGCAGTGTTGG - Intergenic
1169880565 20:10342087-10342109 CATGATGTGGTGAGCAGTGGGGG - Intergenic
1170472457 20:16681856-16681878 CAGGATCTGCTGGGTAGAGAGGG + Intergenic
1172583147 20:36064407-36064429 CAGGGTCAGGTGAGCAGCTGGGG + Intergenic
1173472102 20:43332165-43332187 AAGGATCTGGTGGGGTGGGGCGG + Intergenic
1173853044 20:46231016-46231038 CAGGAGCAGGGGGGCAGAGGAGG + Intronic
1175380174 20:58557393-58557415 CAGGAGCTGGAGGGAAGAGGAGG + Intergenic
1175723424 20:61300983-61301005 CATGAGCTGCTGGGCAGCCGTGG + Intronic
1176171766 20:63699412-63699434 CAGGGGCTGGTGGGCAGGTGAGG - Exonic
1176186701 20:63784137-63784159 CAGGAACTGGTGAGCGGAGGGGG - Intronic
1178638966 21:34330544-34330566 CAGGCTCTGCTGAGCAGCAGAGG - Intergenic
1180000525 21:44993472-44993494 CGGGTCCTGGTGGGCAGCAGAGG - Intergenic
1180834805 22:18924657-18924679 CAGCCTCTGGGGGCCAGCGGTGG - Intronic
1180972952 22:19825063-19825085 GAGGACCTGGTGGGCTGGGGTGG - Intronic
1180981346 22:19879535-19879557 CAGGATGTGGTGGGGGGCGGGGG + Intronic
1181133094 22:20745837-20745859 CAGCACCTGGTGGGCAGTGCAGG + Intronic
1181275684 22:21686372-21686394 CAGGGCCTGGGGGGCAGGGGTGG + Intronic
1181522318 22:23456787-23456809 CAGGATGTGGTGGGGCTCGGAGG - Intergenic
1181570632 22:23766246-23766268 CAGGGGCTGGGGGGCAGCGGGGG + Exonic
1181960544 22:26619004-26619026 CAAGATGTGGTGGGCATCTGGGG - Intergenic
1183484015 22:38079803-38079825 ATGGATCTGATGGGCAGAGGAGG - Intronic
1184099816 22:42336174-42336196 CGGGATCTGTTGGGGAGGGGTGG + Intronic
1184417959 22:44363200-44363222 CAGCTCCTGGTGGGGAGCGGGGG - Intergenic
1184801105 22:46760277-46760299 CAGGATTTTGTGGCCAGCCGGGG + Intergenic
1184852021 22:47126459-47126481 CAGGATCCTGTGGGCCCCGGCGG - Intronic
1185150040 22:49159147-49159169 CAGGATCTCGGGGGCATCTGTGG + Intergenic
1185344140 22:50304099-50304121 CAGGATCTGGGCTGCAGAGGCGG + Intronic
1203284894 22_KI270734v1_random:149956-149978 CAGCCTCTGGGGGCCAGCGGTGG - Intergenic
950476790 3:13219871-13219893 CTGGATATTGTGGGCAGCAGTGG - Intergenic
950976839 3:17255485-17255507 CAGGATCTGGCCGGGTGCGGTGG - Intronic
953800316 3:46017898-46017920 CAGGAGGTGGTGGCCAGTGGAGG + Exonic
953981188 3:47413941-47413963 CAGGATCTGGCGGGCAGGCTGGG + Exonic
954414295 3:50385428-50385450 CAGGTCATAGTGGGCAGCGGGGG - Intronic
956154506 3:66281517-66281539 AAGGATCTGGAGGGCAAGGGAGG - Intronic
957081142 3:75636802-75636824 CAGAATCAGGCAGGCAGCGGGGG - Intergenic
959674479 3:109019242-109019264 CAGGATGTGGTGGACAGCATTGG - Intronic
961336006 3:126180199-126180221 GAGGATCTGGCCGGCCGCGGTGG - Intronic
961585028 3:127915328-127915350 CAGTGGCTGGAGGGCAGCGGCGG + Exonic
961769703 3:129240088-129240110 CAGGAGTTGGTGGGTAGGGGAGG - Intergenic
962325405 3:134428112-134428134 CAGGATCTGGAGGGCCAGGGAGG + Intergenic
962821740 3:139055011-139055033 CAGGAGCAGGTGTGCAGAGGGGG + Intronic
966474293 3:180325756-180325778 GAGGAACTGGTGGGAAGAGGCGG - Intergenic
967074894 3:185993232-185993254 AAGGATGTGCTGGGGAGCGGGGG + Intergenic
967171184 3:186824878-186824900 CAGCATGTGGTGGGCAGGGCTGG - Intergenic
968626131 4:1627517-1627539 CAGGGTCTGCTGGGGAGCTGTGG - Intronic
969133440 4:5010523-5010545 TTGGATCAGGTGGGCAGCTGGGG + Intergenic
969529051 4:7719744-7719766 CAGGCTCTAGGGGGCAGCAGAGG - Intronic
969636080 4:8370232-8370254 CTAGATCTGGTGGGCAGGAGGGG + Intronic
969641653 4:8402291-8402313 CAGGAAGTGAAGGGCAGCGGGGG + Intronic
970972071 4:21996517-21996539 CAGGGTTTGGGGGGCAGCAGTGG + Intergenic
971145676 4:23973894-23973916 CAGCATATGGTGGGCTACGGAGG + Intergenic
975243840 4:72094771-72094793 CAGGCTCTGTGGGGCAGCAGAGG - Intronic
977811915 4:101366171-101366193 CTGGATCTGGTGGAGAGCTGAGG - Intergenic
978309136 4:107366459-107366481 CAGGGTCTGGGGGCCAGCTGTGG - Intergenic
982276283 4:153639855-153639877 TAGGATCTGGTGGGAGGCAGGGG + Intergenic
985449749 4:190054312-190054334 CAGAATAAGGCGGGCAGCGGGGG + Intergenic
985716660 5:1466924-1466946 CGGGGCCTGGTGGGCAGGGGAGG - Intronic
986000023 5:3623074-3623096 CAGGCTCTGGTGAGCACCGCCGG + Intergenic
986199611 5:5569430-5569452 CAGGCCCTGGAGGGCAGCCGAGG - Intergenic
991044831 5:62211586-62211608 CAGGATCTGGCATGCAGCTGCGG + Intergenic
991245130 5:64502575-64502597 CAGGAGCTGGGGGGCAGGGGTGG - Intergenic
992448017 5:76851144-76851166 CAGGAGCTGAGGGGCATCGGAGG + Intronic
992582629 5:78196854-78196876 CAGGAGCTGGTGGGGAGGGAGGG + Intronic
993879894 5:93349661-93349683 CAGGAGCAGGTGGGGAGCGTAGG - Intergenic
994198502 5:96945705-96945727 CAGGCTATGATGGGAAGCGGGGG - Intronic
995623894 5:114056172-114056194 CAGCAGCGAGTGGGCAGCGGGGG + Intergenic
997442584 5:133919162-133919184 GAGGAGCTGGTGTGGAGCGGGGG - Intergenic
997569345 5:134914130-134914152 CAGGATCAGATGGGCAGTGGAGG + Intronic
997735546 5:136210012-136210034 CAGGCTTTGATGGGCAGAGGCGG + Intergenic
999872847 5:155770355-155770377 TAGGATGTGGGGGGCAGGGGTGG + Intergenic
1001639653 5:173235586-173235608 AAGGATGGGGTGGGAAGCGGTGG + Intergenic
1001962790 5:175890331-175890353 CAGGAACTGGGGGCCAGCGTTGG - Intergenic
1002711005 5:181195040-181195062 CAGGCTCTCTTGGGCAGCAGGGG + Exonic
1006150402 6:31983950-31983972 CCGGTGCTGGTGGGCAGAGGTGG - Intronic
1006156703 6:32016688-32016710 CCGGTGCTGGTGGGCAGAGGTGG - Intronic
1006338921 6:33435309-33435331 CTGGGTCTGGTGGGCTGGGGAGG + Intronic
1007210407 6:40189340-40189362 CAGGATGGGGTGGGCAGGGTGGG + Intergenic
1007630982 6:43273473-43273495 GGGGATCAGGTGGGCAGAGGAGG + Intronic
1007715292 6:43852110-43852132 CAGGAAGGGGTGGGCAGCAGAGG + Intergenic
1008548127 6:52601712-52601734 CGGGGTCTGTTGGGGAGCGGTGG + Intergenic
1011271571 6:85585224-85585246 CAGGACCTGCTGGGGAGTGGGGG + Intronic
1011781922 6:90799306-90799328 CAGCATCTGGTGGGCTTCTGGGG + Intergenic
1014932960 6:127355678-127355700 CAGTCTCTGGGCGGCAGCGGTGG - Intergenic
1015918491 6:138242799-138242821 CAAGAGCTGGTGGGTAGGGGTGG + Intronic
1017107513 6:150901647-150901669 CAGGGTCTGGAGGGCAGGGAGGG - Intronic
1018328699 6:162704210-162704232 CAGGCTCAGGTGGACTGCGGGGG + Intronic
1019589017 7:1819803-1819825 CAGGATGTGGTGGGGCTCGGAGG + Intronic
1019919841 7:4156532-4156554 CAGGTTCTGGAGGGCTGCAGTGG + Intronic
1022319127 7:29271835-29271857 CAGCTCCTGGAGGGCAGCGGGGG + Intronic
1023641521 7:42263733-42263755 CAAGATCTGGTGGGGTGCGGTGG - Intergenic
1023862797 7:44226013-44226035 GCGGATCTGGGGGGCAGCTGGGG - Intronic
1024062774 7:45711048-45711070 GAGGAACTTGTGGGCAGCTGAGG + Intronic
1024544516 7:50505990-50506012 GAGGATCAGTTGGGCAGCAGAGG + Intronic
1025615561 7:63113830-63113852 CAGGACCGGGTGGGGGGCGGAGG + Intergenic
1026112634 7:67470375-67470397 CAGGGTCGGGGAGGCAGCGGGGG + Intergenic
1027460541 7:78447538-78447560 GGGGATCTGGAGGTCAGCGGGGG + Intronic
1027461002 7:78453618-78453640 GGGGATCTGGAGGTCAGCGGGGG - Intronic
1028163818 7:87515295-87515317 CTGGCTCTGGTGGGCAGCAGTGG - Exonic
1028299916 7:89185571-89185593 CAGGATCTGGTCGGGCGCGGTGG + Intronic
1029335185 7:99892863-99892885 GAGGATCAGTTGGGCAGCAGTGG - Intronic
1029737514 7:102472892-102472914 CAGGATCTGGTGGGGAGAGAGGG - Exonic
1030243931 7:107360438-107360460 CAGAATGTGGTGAGCAGTGGAGG - Intronic
1031325438 7:120391070-120391092 CAGGGCCTGTTGGGCAGTGGAGG - Intronic
1033633862 7:143189657-143189679 CAGGATGTGGGGGGCGGGGGTGG + Intergenic
1034902100 7:154914224-154914246 CAGGCTCCGGTGCGCCGCGGGGG + Intergenic
1035374785 7:158400896-158400918 CAGGATCTGGGGGAATGCGGGGG - Intronic
1036455318 8:8901799-8901821 CAGGATTCGGTGGGCAGTTGGGG - Intergenic
1037306067 8:17505084-17505106 TGGGATCGGGTGGGCGGCGGGGG - Intronic
1037831834 8:22194411-22194433 CAGGATGGGGTGGGAAGGGGTGG - Intronic
1037881303 8:22574757-22574779 CAGGATGGGGTGGGGAGCGGTGG + Exonic
1039864675 8:41490592-41490614 CAGCAGCTGGAGGGCAGAGGAGG + Intronic
1040336565 8:46419004-46419026 CAGGTTGAGGTGGGCAGAGGGGG + Intergenic
1044678714 8:94755532-94755554 CAGCTTCTTGGGGGCAGCGGGGG + Intronic
1045763009 8:105632458-105632480 CAGGATCTGGTGGTCGGGCGTGG - Intronic
1048317713 8:133374631-133374653 CAGGATCTGGTGCCCAGCTGGGG + Intergenic
1049182562 8:141230539-141230561 CAGGATGGGGTAAGCAGCGGGGG + Intronic
1049551761 8:143263258-143263280 CGGAATCTGGTGTGCAGAGGCGG + Intronic
1049594939 8:143479005-143479027 CAGGCTATGGTGGGCAGTGGGGG - Intronic
1049805111 8:144535179-144535201 CAGTTTCTGGTGGACAGCTGAGG + Intronic
1049833094 8:144714373-144714395 CAGGAAGAGGTGAGCAGCGGCGG + Intergenic
1053265653 9:36711276-36711298 CTGGATCTGGTTGGCAGATGAGG + Intergenic
1055941097 9:81650729-81650751 CTGGATCTGGGGGGAAGAGGAGG + Intronic
1056763048 9:89428237-89428259 CTGGAGCTGGTGGCCAGTGGTGG - Intronic
1056832756 9:89930113-89930135 CAGGAACTTGTGGCCAGAGGTGG - Intergenic
1057920781 9:99094958-99094980 CAGGATCTGGGCAGCAGTGGTGG - Intergenic
1057941469 9:99288932-99288954 CAGGAGCTGGTGGGCTTCGGGGG + Intergenic
1058720521 9:107759905-107759927 CAGGAGCTGCTGGGAAGAGGTGG - Intergenic
1059427775 9:114231819-114231841 CAGGGACTGATGGGCAGCGTGGG + Exonic
1060946774 9:127574363-127574385 GAGGATGTGGTGGGCAGGGGAGG - Intronic
1061415415 9:130444750-130444772 CCGGACCTGGTGGGAGGCGGGGG + Intergenic
1061572624 9:131487168-131487190 CGGGATCTGCTGGGCAGCGGCGG - Exonic
1061726953 9:132587265-132587287 CAGGAGCGGGAGGGCACCGGCGG + Intronic
1061956116 9:133962122-133962144 GAGGAGCTGGTGGGCAGGGTGGG - Intronic
1062155888 9:135048368-135048390 CTGCATCTGGCGGGCAGTGGTGG - Intergenic
1062483817 9:136764491-136764513 CAGGGGCTGGAGGGCAGGGGAGG - Exonic
1062569096 9:137176287-137176309 CAGAAGCTGGGGGGCAACGGAGG + Intronic
1187280982 X:17858718-17858740 CACGGTTTGGTGGGCAGCTGGGG - Intronic
1187343028 X:18438501-18438523 AAGGATCTGGCTGGCCGCGGTGG + Intronic
1187856095 X:23637272-23637294 CAGGCTGTGGTGGGCAGGGCAGG - Intergenic
1188006266 X:25017565-25017587 CGGGCTGTGGTGGGGAGCGGAGG + Intergenic
1188714741 X:33448009-33448031 CAGTATCTGGGGGGCGGGGGAGG + Intergenic
1188973669 X:36647771-36647793 CAAGACCTGGAGGGCAGGGGTGG - Intergenic
1189254122 X:39624149-39624171 CAGGCTCAGGTGGGCAGCAATGG - Intergenic
1189355524 X:40307357-40307379 CAGGGTCTGGCGGTCAGCAGAGG + Intergenic
1190114867 X:47619836-47619858 CAGTCTGCGGTGGGCAGCGGAGG - Exonic
1190582546 X:51903041-51903063 CAGGATCTTATGGGCAGTGAAGG + Intergenic
1192874298 X:75211588-75211610 CAGGATCTGGAGGTCAGCCCAGG + Intergenic
1195319015 X:103706320-103706342 CAGGATCTGTTGGACAGCTGGGG - Intergenic