ID: 1074388087

View in Genome Browser
Species Human (GRCh38)
Location 10:113033201-113033223
Sequence CAGCAGAAGGAGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4910
Summary {0: 1, 1: 8, 2: 132, 3: 979, 4: 3790}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074388087 Original CRISPR CAGCAGAAGGAGGAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr