ID: 1074389017

View in Genome Browser
Species Human (GRCh38)
Location 10:113041472-113041494
Sequence CTGAGTCAGTGGCCAGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074389015_1074389017 -10 Left 1074389015 10:113041459-113041481 CCAATGTCACACGCTGAGTCAGT 0: 1
1: 0
2: 0
3: 13
4: 162
Right 1074389017 10:113041472-113041494 CTGAGTCAGTGGCCAGAGCAAGG No data
1074389013_1074389017 5 Left 1074389013 10:113041444-113041466 CCTTAAGTGAATTGCCCAATGTC 0: 1
1: 0
2: 3
3: 18
4: 156
Right 1074389017 10:113041472-113041494 CTGAGTCAGTGGCCAGAGCAAGG No data
1074389014_1074389017 -9 Left 1074389014 10:113041458-113041480 CCCAATGTCACACGCTGAGTCAG 0: 1
1: 0
2: 1
3: 26
4: 163
Right 1074389017 10:113041472-113041494 CTGAGTCAGTGGCCAGAGCAAGG No data
1074389012_1074389017 14 Left 1074389012 10:113041435-113041457 CCAGAGATGCCTTAAGTGAATTG 0: 1
1: 0
2: 0
3: 10
4: 80
Right 1074389017 10:113041472-113041494 CTGAGTCAGTGGCCAGAGCAAGG No data
1074389011_1074389017 15 Left 1074389011 10:113041434-113041456 CCCAGAGATGCCTTAAGTGAATT 0: 1
1: 0
2: 0
3: 9
4: 156
Right 1074389017 10:113041472-113041494 CTGAGTCAGTGGCCAGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074389017 Original CRISPR CTGAGTCAGTGGCCAGAGCA AGG Intronic
No off target data available for this crispr