ID: 1074390110

View in Genome Browser
Species Human (GRCh38)
Location 10:113049995-113050017
Sequence GGCTCAGATGTGGCACAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074390110_1074390117 20 Left 1074390110 10:113049995-113050017 CCCAACTGTGCCACATCTGAGCC 0: 1
1: 0
2: 0
3: 13
4: 155
Right 1074390117 10:113050038-113050060 TGCAGCCTGACTGCAATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074390110 Original CRISPR GGCTCAGATGTGGCACAGTT GGG (reversed) Intronic
900767217 1:4513510-4513532 GGCCCAGATGGGGCACATCTTGG - Intergenic
900811021 1:4801446-4801468 GGCTCAGATGTGCCCGACTTGGG + Intergenic
901930157 1:12591981-12592003 GGCTCTGATGGGGCTCAGGTGGG + Intronic
902715769 1:18271732-18271754 AGCTAAGAAGTGGCACAGGTGGG - Intronic
902907794 1:19571745-19571767 GGCTAAGAGGTGGCACCTTTGGG + Intergenic
903798688 1:25950226-25950248 GGCTCAGAAGTGGCACAGGGTGG - Intergenic
904964086 1:34358334-34358356 GTCTCTGCTGTGGCACAGCTTGG + Intergenic
906724917 1:48037170-48037192 GGCTCAGATTTGGCACCCTGGGG + Intergenic
910048966 1:82954887-82954909 GGCTTAGTTGTGGCAGAGATGGG + Intergenic
913252511 1:116923746-116923768 TGCTCAGATGTGGCTCAGTGTGG - Intronic
916054148 1:161056303-161056325 GGCTAGTATGTGGCACACTTGGG + Intronic
921097048 1:211895600-211895622 GGCCCAGATAAGGCACAGCTGGG + Intergenic
921221148 1:212974835-212974857 AGCTAACACGTGGCACAGTTGGG - Intronic
921458172 1:215396617-215396639 ATCTCAGATGTGGCAGAGTTGGG + Intergenic
922201980 1:223411695-223411717 GTCCCAGTTGTGGCACAGTGAGG + Intergenic
922789200 1:228301010-228301032 GGCTAAGATTTGGGACTGTTAGG - Intronic
923864907 1:237929356-237929378 AACTCATATGTGGCACAGCTGGG - Intergenic
1063994814 10:11609818-11609840 GTGTCAGATTTGGCACTGTTAGG - Intronic
1068395576 10:56457021-56457043 GGCCCATATGTGGTACATTTGGG - Intergenic
1069825263 10:71251015-71251037 GACTCAGATCTGGCTCAGTTGGG + Intronic
1074390110 10:113049995-113050017 GGCTCAGATGTGGCACAGTTGGG - Intronic
1075833202 10:125428548-125428570 GACTCAGATGTCCCACAGTGGGG + Intergenic
1081111323 11:39137632-39137654 GACTCAGCAGTGGCCCAGTTAGG - Intergenic
1083854361 11:65385340-65385362 GGCTCAGCTGTGGGGCAGTGTGG + Intergenic
1091949715 12:4582755-4582777 TGCTGAGATGTGGAACAGTGCGG + Intronic
1092629622 12:10363903-10363925 AGCTCAGCTGTGGCACACCTTGG - Intergenic
1096053592 12:48632263-48632285 GGCTCAGCTGAGGGAAAGTTGGG - Intergenic
1098496303 12:71139540-71139562 GGCTTAGATTTGGCTTAGTTTGG - Intronic
1099803075 12:87481629-87481651 GGCTCAGATGTGGGAGTGGTTGG + Intergenic
1102924551 12:116816631-116816653 AGCTCAGATGTAGCAGAGGTGGG - Intronic
1103157535 12:118698921-118698943 GGCTCCCATGTGGCGCAGTCTGG - Intergenic
1103212352 12:119176188-119176210 GCCTCAAATGAGGCTCAGTTGGG - Intergenic
1103219398 12:119231273-119231295 AGCCCAGGTGTGGCACAGTCAGG + Intergenic
1104049389 12:125185929-125185951 GGGTTAAATGTGGCACAGCTAGG - Intergenic
1106641260 13:31586845-31586867 GCCCCAGCTGTGGCACAGATAGG + Intergenic
1107373614 13:39778679-39778701 GATTCAGAAGTGGCATAGTTGGG + Intronic
1107729794 13:43337273-43337295 GGTCCAGAAGTGGCACAGTGAGG + Intronic
1112100678 13:96185509-96185531 CCCTCAGCTGTGGCACAGTGAGG - Intronic
1113964472 13:114144870-114144892 GGCTCGGATGTAGCAGAGGTGGG - Intergenic
1114458874 14:22874332-22874354 GTCTCACATCTGGCACAGTGGGG + Intronic
1117230961 14:53718188-53718210 AGCTCAGATGTGGGAGAGATGGG + Intergenic
1122945751 14:105008122-105008144 GGCCCAGATGTGGCCCAGCAGGG + Intronic
1125733436 15:41907223-41907245 GCCTGAGCTGTGGCCCAGTTGGG - Intronic
1126733868 15:51712260-51712282 GGCTCAGATGGGGCTCAGAATGG + Intronic
1127288337 15:57549404-57549426 GGCTCTGACCTGGCACAGGTGGG - Exonic
1127803234 15:62495401-62495423 GTTTCAGAAGTGTCACAGTTGGG - Intronic
1129388278 15:75207627-75207649 GGCTCAGCTGTGGCAGAGTCAGG - Exonic
1129663717 15:77567539-77567561 GGCTGGGATGGGGCAGAGTTGGG - Intergenic
1129869490 15:78931581-78931603 GCCTCAGATGTGGCTCAGCCAGG - Intronic
1129870724 15:78939057-78939079 GTCTCAAATCTGGGACAGTTTGG + Intronic
1131761489 15:95627468-95627490 GGTTCAGATGTAGCACTGATGGG + Intergenic
1132996827 16:2827840-2827862 AGCTCAGATGTGGCACAAAGGGG - Intergenic
1136399034 16:30007842-30007864 GGCTCAGAAGTGGCAGGGCTGGG - Intronic
1136485697 16:30570585-30570607 GGCTCAGATAAGGCACTTTTAGG - Intronic
1138109897 16:54315462-54315484 GACTCGGATGTGGCACAGCTGGG - Intergenic
1139094769 16:63692183-63692205 GGTTCAGATATTCCACAGTTTGG + Intergenic
1139255319 16:65535518-65535540 GGCTAGAATGTGGCAGAGTTTGG - Intergenic
1139286609 16:65820744-65820766 GGCTCCTATGTGCCACAGGTGGG + Intergenic
1140126126 16:72120312-72120334 GGCCCAGAGCTGGCAGAGTTGGG - Intronic
1141202662 16:81909927-81909949 GGTTCATATGTGGCAGAGCTGGG + Intronic
1141669021 16:85481866-85481888 GGCGCAGAGGTGGCAGAGCTGGG + Intergenic
1141869820 16:86777477-86777499 GGCTCTGATGTGGGAGAGTTTGG - Intergenic
1144369072 17:14572822-14572844 CACTCAGAAGTGGCACAGTATGG - Intergenic
1144853060 17:18253793-18253815 AGCTCAGAGGTGGCAGAGCTGGG - Intronic
1145086491 17:19946401-19946423 AGCTCAGATATGGCAGAGTCAGG - Intronic
1152518684 17:80842181-80842203 GGCTCTGATGTGACAGAGTCTGG - Intronic
1152589226 17:81203191-81203213 AGCCCAGATGTGGCACAGTGAGG - Intronic
1153057904 18:966146-966168 GACTCAACTGTGGCACAGATAGG - Intergenic
1158201030 18:54940506-54940528 GGCTCAGATGTGGTTTAGCTTGG + Intronic
1161251122 19:3280945-3280967 GGCTGTGATGGGGCACAGGTGGG - Intronic
1162532400 19:11243436-11243458 GACTCAGGGGCGGCACAGTTCGG + Intronic
1163906592 19:20154150-20154172 GGCCAAAAAGTGGCACAGTTTGG - Intergenic
1168099036 19:54131237-54131259 GGCTCTGATGGGTCACAGTTGGG + Intronic
925874953 2:8303639-8303661 GGCTCCGATGTGGCCACGTTTGG - Intergenic
928699123 2:33880854-33880876 GCCTGAGATGAGGCATAGTTTGG + Intergenic
929004816 2:37384349-37384371 GGCACAGATGGGACACAGCTTGG + Intergenic
929762325 2:44816488-44816510 TGTTGAGATGTGGGACAGTTGGG + Intergenic
930688351 2:54332524-54332546 GGCTCAGATATGGCAGAACTGGG + Intronic
932231086 2:70085245-70085267 GGCTCAAATGTGCCACAGACAGG + Intergenic
933189803 2:79321960-79321982 TGCTCAGTAGTGGCATAGTTGGG - Intronic
936025940 2:109031306-109031328 GGCTCTGATGTGGCAGGGGTGGG + Intergenic
936347261 2:111684629-111684651 GGGTCAGAAGTGTCACAGATAGG - Intergenic
936781931 2:116043782-116043804 GACTCAGATGTACAACAGTTAGG + Intergenic
937394939 2:121526378-121526400 GGCTCAGATGTGCCCCAGTAGGG - Intronic
938384417 2:130854244-130854266 GGATCAGCAGTGGCACAGTCTGG + Intronic
939121540 2:138123532-138123554 AGCACAGATGTGGCACAGGGTGG + Intergenic
942575403 2:177357827-177357849 GGCTAAGCTTTGGCAAAGTTGGG - Intronic
942611377 2:177745648-177745670 GGCTCTGATGTGGCCCAGAGAGG - Intronic
943136674 2:183921995-183922017 GGCTCAGTTGACTCACAGTTCGG - Intergenic
947874966 2:233461811-233461833 GGCTGAGATGTGGCTCAGGCAGG - Intronic
1169775123 20:9243757-9243779 GGCTAGGAAGTGGCACAGCTGGG - Intronic
1170586657 20:17739916-17739938 GCCTTCGATGTGGCACACTTTGG - Intergenic
1171949934 20:31412402-31412424 GGCTAATATGTGGCAAAGTGAGG - Intronic
1172355887 20:34279472-34279494 GGCTGAGATCTTGCACACTTGGG - Intergenic
1172617722 20:36300217-36300239 GGCTCAGATGTGCCCCAGCCTGG + Intergenic
1172766714 20:37355030-37355052 GGCTTGGAGGTGGCACAGTTTGG + Intronic
1173572842 20:44088579-44088601 ATCTCAGATGTGGTACAATTGGG + Intergenic
1175315899 20:58046479-58046501 AGCTCAGAGGTGGCAGAGATAGG + Intergenic
1176673435 21:9755045-9755067 GGCTAGGATGTGGAGCAGTTGGG + Intergenic
1181106449 22:20578651-20578673 AGCTCAGATGGGACACAGTGGGG - Intronic
1182706080 22:32281309-32281331 TGCTCAGATGCGGCCCCGTTGGG - Intergenic
1184209711 22:43028348-43028370 GTCTCACATTTGGCACATTTGGG - Intergenic
1184409593 22:44318868-44318890 AGCTCATATGTGGCAGACTTGGG + Intergenic
1184963173 22:47946462-47946484 AGCTCAGCTGTGGTACAGGTGGG - Intergenic
1185202575 22:49517187-49517209 GGCTCAGGTGTGGCTGAGATGGG - Intronic
950028105 3:9834469-9834491 AGCTCAGAAGGGGCACAGCTGGG + Intronic
951685869 3:25343796-25343818 TGTTCAGGTGTGGCAAAGTTTGG + Intronic
952980516 3:38730748-38730770 GCATCAGATTTGACACAGTTTGG + Intronic
958657502 3:97021194-97021216 GGCACAAATGTGGAACTGTTAGG - Intronic
958733413 3:97982765-97982787 GGCTTATAAGTGGCACAGTAAGG + Intergenic
958927559 3:100175709-100175731 TCCTCAGATGTCTCACAGTTGGG - Intronic
960548439 3:118945683-118945705 GGACCTGATGTGGAACAGTTGGG - Intronic
961636110 3:128334143-128334165 GACTCAGATGTGGCAGAGGCAGG - Intronic
961812807 3:129531479-129531501 GGCTGAGATGAGACACAGTGGGG + Intronic
962916116 3:139905516-139905538 AGCTAAGACGTGGCACAGTGAGG + Intergenic
964458267 3:156892856-156892878 GGCTAAAATTTAGCACAGTTTGG + Intronic
967910709 3:194540402-194540424 GGTGCAGATGTGGCACAGGAGGG - Intergenic
970672493 4:18412885-18412907 AGCTGAGATGTGGCACAACTGGG + Intergenic
970869484 4:20799084-20799106 GGCTCAGGTATGGCACACTATGG - Intronic
976653674 4:87464018-87464040 GCCTAAGATCTGTCACAGTTGGG - Intergenic
977530882 4:98199470-98199492 GGCACAGATGTGGCCCAGGCAGG + Intergenic
981809669 4:148759528-148759550 GTCTCAGAGGTGGCAGAGGTGGG + Intergenic
982334854 4:154223387-154223409 GGCTCAGAGGTTGGAGAGTTGGG - Intergenic
988063532 5:26204414-26204436 GGTTCAGAAGTGGAAGAGTTTGG + Intergenic
997412131 5:133698414-133698436 GGCTGATAAGTGGCAGAGTTGGG - Intergenic
1002361283 5:178673283-178673305 GACTCAGATATGGCAGAGGTTGG + Intergenic
1003610290 6:7607477-7607499 GGCATAGATGTGGCACAGTGTGG - Intronic
1006025127 6:31141880-31141902 GGCCGAGATGTGGCCAAGTTTGG - Intergenic
1006577880 6:35059333-35059355 GGCTCAGGTGTGGCTCTGCTGGG - Intronic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1006837534 6:37008009-37008031 GGCTCGGAAGTGGCAGAGGTGGG - Intronic
1007423556 6:41733904-41733926 GGCCCAGACCTGGCACTGTTGGG - Intronic
1007476293 6:42122098-42122120 GTCTGAGCTGTGGCACAGTGTGG - Intronic
1016341616 6:143067430-143067452 GTCTCAGATGTGGAAAAGCTTGG + Intronic
1017256967 6:152344212-152344234 GTCTCAGATGTACCAGAGTTTGG - Exonic
1019209149 6:170390957-170390979 GGGCCAGATGTGGCAAAGTAGGG - Intronic
1019559580 7:1649267-1649289 GGCCCGTATGTGGCACAGCTGGG - Intergenic
1020670511 7:11102501-11102523 GGATGAGCTGTGGCAGAGTTGGG - Exonic
1020697544 7:11432990-11433012 AGGGCAGATGTGGCAGAGTTGGG + Intronic
1021246919 7:18274546-18274568 GTCTCTGATGTGGCAGTGTTGGG - Intronic
1024009950 7:45259015-45259037 AGCACAGATGTGGCACATTCAGG - Intergenic
1028037468 7:86003144-86003166 GGGTCATATGTGGCACATGTGGG + Intergenic
1028451927 7:90994819-90994841 GCCTCAGATGTGTCACACTATGG - Intronic
1035604698 8:922026-922048 GGCCCGGGTGTGGCACAGCTGGG + Intergenic
1037527385 8:19740179-19740201 GGACCAGATGTGGCCCAGGTGGG - Intronic
1042791836 8:72616439-72616461 GGCTGAGATGTGGCTGACTTTGG - Intronic
1042960169 8:74294900-74294922 GCCTGAGACGTGGAACAGTTAGG + Intronic
1043751642 8:83943482-83943504 GGCTCACATCTGGCACAAATGGG + Intergenic
1045643153 8:104273821-104273843 AGCTCAGATGTGAGACTGTTTGG - Intergenic
1045738596 8:105325284-105325306 AGCTCAGATGTGGCAATATTTGG + Intronic
1048196026 8:132332440-132332462 GGGGTAGAGGTGGCACAGTTTGG - Intronic
1048664777 8:136648785-136648807 GCCTCATATCTGGCACTGTTGGG - Intergenic
1050272336 9:3959552-3959574 GTCACAGATGTGGCAGAGATTGG - Intronic
1050621452 9:7456357-7456379 GGCTCAGAGGTAGCCCAGGTTGG - Intergenic
1051331160 9:16026216-16026238 GGCTCTGGTGTGGCAGGGTTAGG - Intronic
1053045161 9:34909430-34909452 GGCCTAGATGAGGCTCAGTTTGG - Intergenic
1056786767 9:89598095-89598117 TGCCCAGCTGTGGCACAGTGGGG + Intergenic
1059508178 9:114818959-114818981 GGGTCAGATGTGGCTGGGTTGGG + Intergenic
1062501315 9:136853188-136853210 TGCTCAGATGAGGCCCAGTGTGG + Exonic
1185801799 X:3017801-3017823 GACTCAGATGTGCCACAGTAAGG - Intronic
1186331037 X:8534427-8534449 GTCTCAGATTGGGCACTGTTAGG + Exonic
1186462092 X:9755948-9755970 GGTTCAGATGTGTAAGAGTTTGG + Intronic
1187493085 X:19771087-19771109 GAGTCTGATGTGGCACACTTTGG + Intronic
1189179965 X:38994490-38994512 GATTCAGAAGTGGCTCAGTTGGG + Intergenic
1192310066 X:70004192-70004214 GGCTCAGTTCTGGCTTAGTTTGG - Intronic
1195671397 X:107473168-107473190 GGCTAATAAGTGGCAGAGTTGGG + Intergenic
1196623027 X:117845698-117845720 TGCTCAGTAGTGGCAGAGTTAGG - Intergenic
1198058634 X:133021085-133021107 AGGGCAGATGAGGCACAGTTAGG + Intergenic
1199565659 X:149213104-149213126 GGATCACATCTGGAACAGTTTGG - Intergenic