ID: 1074390404

View in Genome Browser
Species Human (GRCh38)
Location 10:113052835-113052857
Sequence ATGTCTAATAGAAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074390404_1074390408 11 Left 1074390404 10:113052835-113052857 CCTCCCACCTTTCTATTAGACAT 0: 1
1: 0
2: 0
3: 14
4: 167
Right 1074390408 10:113052869-113052891 AAAATCAAGATATTTCTAAGAGG No data
1074390404_1074390409 12 Left 1074390404 10:113052835-113052857 CCTCCCACCTTTCTATTAGACAT 0: 1
1: 0
2: 0
3: 14
4: 167
Right 1074390409 10:113052870-113052892 AAATCAAGATATTTCTAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074390404 Original CRISPR ATGTCTAATAGAAAGGTGGG AGG (reversed) Intronic
900861523 1:5236076-5236098 AGTTCTAAAGGAAAGGTGGGGGG + Intergenic
901909288 1:12441674-12441696 ATATCTAGCAGGAAGGTGGGGGG - Intronic
902189270 1:14750006-14750028 ATGACCAAAAAAAAGGTGGGGGG + Intronic
904235477 1:29113905-29113927 AGGTTTCATAGAGAGGTGGGCGG + Intronic
905771953 1:40644045-40644067 ATGCTTACAAGAAAGGTGGGGGG + Intronic
908491310 1:64646723-64646745 CTGTCTCAAAAAAAGGTGGGGGG + Intronic
910445176 1:87292595-87292617 ACAACTAAGAGAAAGGTGGGAGG + Intergenic
912617106 1:111113971-111113993 ATATATAATTGAAAGGAGGGAGG - Intergenic
914701856 1:150141617-150141639 ATGTATAGAAGGAAGGTGGGTGG - Intronic
917075785 1:171203214-171203236 ATGTCTGATACTGAGGTGGGAGG + Intronic
919023371 1:192136907-192136929 ATGCCTAATAGAATGGCTGGGGG - Intergenic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921902559 1:220466133-220466155 TTGTGGAATAGAAAGGGGGGAGG - Intergenic
923146418 1:231201914-231201936 ATGTATAATAGAATGTTGGATGG + Intronic
924461311 1:244261331-244261353 ATGTCCTTTAGCAAGGTGGGGGG + Intergenic
1069632642 10:69906378-69906400 ATGACAGATAGAAGGGTGGGAGG + Intronic
1070583938 10:77746921-77746943 TTGACTGATAGAAAGATGGGAGG + Intergenic
1073073339 10:100808551-100808573 ATGGCTAACAGAAGGGTAGGAGG - Intronic
1074390404 10:113052835-113052857 ATGTCTAATAGAAAGGTGGGAGG - Intronic
1074440537 10:113473887-113473909 ATCTTTAATAAAAAGATGGGTGG + Intergenic
1075307962 10:121384644-121384666 ATCTCAAAAAAAAAGGTGGGGGG - Intergenic
1078947860 11:16091338-16091360 ATTTCTAATAGAGAAGAGGGTGG - Intronic
1079670840 11:23168899-23168921 ATGTCTCATAGAGAGGGGTGTGG + Intergenic
1082185527 11:49175946-49175968 GTGTCCAATAGAAAAATGGGTGG - Exonic
1083997587 11:66279735-66279757 ATGTCAAAGAGCAAGGTGGCAGG - Intronic
1085643224 11:78206352-78206374 ATGTCTAATACCAGGATGGGTGG - Intronic
1086234010 11:84605695-84605717 CTGTCTATTAGAAAGGTGTTTGG + Intronic
1091494922 12:964236-964258 ATGTTGAAAAGAAAGGTGGGGGG + Intronic
1094314740 12:29127156-29127178 ATGAATAATAGAAAGGTAGCTGG - Intergenic
1097724397 12:63058334-63058356 ATGTCTAAAAGGCTGGTGGGAGG + Intergenic
1099326015 12:81215235-81215257 ATGACAAAAAAAAAGGTGGGGGG - Intronic
1099531728 12:83790319-83790341 ATGGCGAAAAAAAAGGTGGGGGG - Intergenic
1101662443 12:106777619-106777641 AAGTGTAGTAGAAAGGTGGTGGG + Intronic
1102669349 12:114604049-114604071 AAATCTAAGAGAAAGGTGGATGG - Intergenic
1102900038 12:116629346-116629368 CTGTCTCATAGAAAGGAAGGAGG + Intergenic
1107317699 13:39151262-39151284 ATGTAAAAGGGAAAGGTGGGGGG + Intergenic
1108467548 13:50732136-50732158 CTGTGTTATAGAAACGTGGGTGG - Intronic
1109826590 13:67729349-67729371 ATTTCTAATATAAAGGAGAGAGG + Intergenic
1111396564 13:87674223-87674245 AGGCAAAATAGAAAGGTGGGAGG - Intronic
1111550331 13:89801525-89801547 ATGGCTAATATAAAAGTTGGAGG + Intergenic
1114467047 14:22930551-22930573 CTGTGTAATAGAAAGTTGGATGG + Intergenic
1114557287 14:23569274-23569296 AGGTCTAAAGAAAAGGTGGGAGG + Exonic
1114758816 14:25288796-25288818 ATGTCAAAAAGCAAGGTTGGAGG + Intergenic
1116147347 14:41091525-41091547 ATGAATAATAATAAGGTGGGAGG - Intergenic
1116695615 14:48173154-48173176 AAGTATCATAGTAAGGTGGGTGG + Intergenic
1117845060 14:59902312-59902334 ATATCTTATACAAAGTTGGGAGG - Intergenic
1119546607 14:75476570-75476592 TTGACTAATTGAGAGGTGGGAGG + Intergenic
1120285575 14:82496263-82496285 ATGACAAAAAAAAAGGTGGGGGG + Intergenic
1120855538 14:89208873-89208895 ATGTTTAAGAGACAGGTGGAGGG - Intronic
1125392602 15:39210827-39210849 ATATCTAATAGAAAGTTGGAAGG + Intergenic
1126292348 15:47096295-47096317 CTGTGGAATAGAAAGGTGGAAGG + Intergenic
1126452705 15:48826866-48826888 ATGCCTATTAGAAAGGTCTGAGG - Intronic
1129192866 15:73947598-73947620 ATATCTAATAGCCAGGTGGGAGG - Intronic
1131286581 15:91064104-91064126 ATGTCAAGTAGACAGTTGGGTGG - Intergenic
1135608513 16:23844424-23844446 ATGATGAATAGAGAGGTGGGTGG - Intronic
1137494548 16:48959630-48959652 CTGTCTGATAGAGATGTGGGAGG + Intergenic
1141108048 16:81249776-81249798 AGGTCTAAGAGAAAGATGGAGGG - Intronic
1142275208 16:89114787-89114809 ATGTCTCAGAGGAAGGCGGGGGG + Intronic
1146072782 17:29699571-29699593 ATGTCAAGTAGAAACCTGGGTGG + Intronic
1146109624 17:30076449-30076471 ATTACTAAGAGAAAGGTGAGTGG + Intronic
1147895356 17:43747417-43747439 ATATCTAAAAGAAATATGGGCGG + Intergenic
1148377065 17:47158194-47158216 ATGTGAAATAGGTAGGTGGGTGG - Exonic
1148592390 17:48826346-48826368 ATTTCTAATAGAAATGTCGTGGG - Intergenic
1149118244 17:53126695-53126717 ATTTCTAAAAGAAGGGTGGGAGG - Intergenic
1151005152 17:70427029-70427051 ATGTCCAATAGGAGGGTAGGAGG - Intergenic
1151128377 17:71870007-71870029 ATTTCTAGTAGAAAGGTAGGAGG - Intergenic
1152213948 17:79021393-79021415 ATGATTAATAAAAAGGTTGGTGG - Intergenic
1152448040 17:80357411-80357433 GTGTCTGATAGACAGGTGGATGG - Intronic
1155615940 18:27721474-27721496 ATCTCTAAGAGAGAGGAGGGAGG + Intergenic
1156320991 18:36021992-36022014 ATATCTCAAAAAAAGGTGGGGGG + Intronic
1157797794 18:50591341-50591363 ATGTAGAATGAAAAGGTGGGAGG - Intronic
1158414172 18:57234660-57234682 ATGAGGAAAAGAAAGGTGGGAGG + Intergenic
1159578851 18:70211989-70212011 ATTTCTACTAGAAAGGCAGGTGG - Intergenic
925789517 2:7469837-7469859 ATGATAAATATAAAGGTGGGGGG - Intergenic
925803947 2:7630023-7630045 ATGTAAAATAGAAATGGGGGAGG + Intergenic
925840933 2:7991308-7991330 AACTCTAATGGAAAAGTGGGAGG + Intergenic
927018056 2:18988121-18988143 ATGTCTCATACAAATGTGAGTGG - Intergenic
928964667 2:36965619-36965641 ATACCTAAAAGAAACGTGGGAGG + Intronic
929105666 2:38363354-38363376 TTGTTTATTAAAAAGGTGGGGGG + Intronic
929436010 2:41928944-41928966 ATGTCCAAGAGAAAGGAGGCTGG - Intergenic
929716095 2:44311401-44311423 ATGGCTCATATAATGGTGGGGGG - Intronic
930207173 2:48599439-48599461 ATTTCTTATAAAAAGGAGGGTGG - Intronic
932063917 2:68533055-68533077 ATCTCTAAAAAAAAGGTCGGGGG + Intronic
932807048 2:74793295-74793317 CTGTCTAACAGGAGGGTGGGTGG + Intergenic
932972027 2:76555492-76555514 ATTTTTAAAACAAAGGTGGGAGG + Intergenic
932987928 2:76748923-76748945 ATGAGAAATAGAAAGATGGGTGG + Intronic
936877781 2:117213301-117213323 ATCTCTAGTAGGAAGATGGGTGG - Intergenic
937094266 2:119225272-119225294 ATGTCTAATGGGTAAGTGGGCGG + Intronic
940323825 2:152404121-152404143 ATGTCCAAAAAAAAGGCGGGGGG - Intronic
943121974 2:183747832-183747854 ATGTTTAATTGAATGGTGGTTGG - Intergenic
944506062 2:200412526-200412548 AGGTCTCATAGAAATGTGCGAGG + Intronic
944721649 2:202428698-202428720 ATGTGTAAGAGAAAGGCTGGAGG - Intronic
947369878 2:229434251-229434273 ATGACTAATAGAAAGCTTAGAGG - Intronic
948319522 2:237058381-237058403 ATGCCTAAGAGAAATGCGGGGGG - Intergenic
948959999 2:241327114-241327136 ATGTCTAATAGAAAATTGTGTGG + Intronic
1169626865 20:7580917-7580939 AAGTCGAATGGAAAGGTGGTGGG + Intergenic
1171000687 20:21412836-21412858 CTGTCTAAAAAAAAGGAGGGAGG - Intergenic
1172960121 20:38793123-38793145 ATGTCTTCTACACAGGTGGGAGG + Intergenic
1173976456 20:47190290-47190312 ATGATTAATTGGAAGGTGGGTGG + Intergenic
1175435260 20:58942530-58942552 ATATCTTAGAGAAGGGTGGGTGG + Intergenic
1176877239 21:14144036-14144058 ATGTCTACTATAAAGGTGTGAGG - Intronic
1177903868 21:26951472-26951494 ATGTCTAGTAAAAAGGAAGGGGG + Intronic
1178072447 21:28983674-28983696 ATGGCTAATTGAAAGGAGGAAGG + Intronic
1178360321 21:31944080-31944102 ATCTCAAAAAGAAAGGTGGGAGG - Intronic
1183148072 22:36013780-36013802 GTGTCAAAAAGAAAGGAGGGGGG + Intronic
1184316457 22:43696425-43696447 ATGTCTAATAGTAAAATTGGTGG - Intronic
1184900627 22:47444415-47444437 ATGTCTGATGGGCAGGTGGGTGG + Intergenic
949987300 3:9551432-9551454 ATCTCTGATCGAAAGGTGGGTGG + Intronic
954288011 3:49632785-49632807 GTGTCTAAAAAAAAAGTGGGGGG + Intronic
954853794 3:53625725-53625747 AGGTCTAATAGAAATCTGGGTGG - Intronic
956359927 3:68437085-68437107 ATGTTTAAAAGAAAGCTGGGAGG + Intronic
958061682 3:88491448-88491470 ATGTCTAATACAAAGAAGGCTGG + Intergenic
959154509 3:102650142-102650164 ATCTCTATCACAAAGGTGGGAGG - Intergenic
960763579 3:121099178-121099200 AGATATAATAGAAAGGTTGGTGG + Intronic
966950653 3:184813433-184813455 ATATCTAATATAAATGTGGATGG + Intronic
968931196 4:3580396-3580418 ATGATGAATGGAAAGGTGGGTGG - Intronic
969350588 4:6596019-6596041 ATGGCTAATGGTGAGGTGGGTGG + Intronic
969911566 4:10451928-10451950 ATGTGAAAAGGAAAGGTGGGTGG + Intronic
970988535 4:22186690-22186712 ATGTTTTATTAAAAGGTGGGGGG + Intergenic
974049552 4:56927811-56927833 GTATTTTATAGAAAGGTGGGGGG + Intronic
975347310 4:73306930-73306952 ATGTCTAATAATAAGGAGGTTGG - Intergenic
975399527 4:73918439-73918461 ATCTCTAATAGAAAAGTAAGTGG - Intergenic
975630682 4:76399262-76399284 ATTTCAAATAAAAAGCTGGGAGG + Intronic
976457863 4:85270053-85270075 ATGGCTGATAGAATGGTGGCTGG - Intergenic
978780189 4:112544043-112544065 ATGTCTAATACAAAAGAGGTTGG + Intronic
979205968 4:118038371-118038393 ATTTCTAATACAAAGATGGAGGG + Intronic
979360162 4:119753218-119753240 ATTTCTAAAAGAAAAGTGAGAGG - Intergenic
980228893 4:130022398-130022420 AAGTCTAATAGGAAAGAGGGAGG - Intergenic
980490417 4:133518327-133518349 ATGTCTAAGACAAAGATGGATGG + Intergenic
980504991 4:133707160-133707182 AAGTATAAAAAAAAGGTGGGGGG - Intergenic
983588192 4:169378699-169378721 CTGTCTCAAAAAAAGGTGGGGGG - Intergenic
984676624 4:182556144-182556166 TGGTCTACTAGGAAGGTGGGAGG - Intronic
987819565 5:22945383-22945405 AAGTCTTATATAAATGTGGGAGG - Intergenic
987908447 5:24109234-24109256 ATGTCTAATGGAAGGGGGGTAGG + Intronic
988636338 5:32988640-32988662 CTGTCTACTAGGGAGGTGGGGGG - Intergenic
997833335 5:137171840-137171862 ATGTTTATTAGAAAGGTACGAGG - Intronic
999661873 5:153873122-153873144 ATTTCTAATATAAAGGTGGTAGG + Intergenic
1000222103 5:159224070-159224092 ATGTCTAATAGGCATGTTGGAGG + Intergenic
1001402116 5:171451672-171451694 GTGTCCCATAGCAAGGTGGGAGG - Intronic
1005211374 6:23468220-23468242 ATGTTTAATAGAAAGGTCTCTGG - Intergenic
1006051965 6:31352240-31352262 ATGTCTACTAGGAAGGCAGGTGG - Intronic
1007209902 6:40184952-40184974 ATTTCTAATACAAGGCTGGGAGG - Intergenic
1007504676 6:42326482-42326504 ATGAATGACAGAAAGGTGGGTGG + Intronic
1013441349 6:110173491-110173513 ATGGCTAATAGAAATGGAGGTGG - Intronic
1013618314 6:111865444-111865466 TGGTCTAATAAAAACGTGGGAGG - Intronic
1013981528 6:116135414-116135436 TTGTTAAATAAAAAGGTGGGGGG - Intronic
1014873556 6:126627502-126627524 ATGGATATTAGAAAAGTGGGAGG - Intergenic
1017030571 6:150217836-150217858 AGGTCTAATTAAAAGGGGGGAGG + Intronic
1018789445 6:167135374-167135396 ATGTCTACTGGAAAGGTCTGCGG + Intronic
1019941332 7:4294079-4294101 ATGCCTGATAAAAAGCTGGGAGG + Intergenic
1021310678 7:19092206-19092228 ATGTGTAATTAAAAGCTGGGTGG - Intronic
1021908424 7:25359723-25359745 AAGGTTAAAAGAAAGGTGGGGGG + Intergenic
1029456423 7:100674515-100674537 TTGCCTAAAAGAAAGCTGGGCGG - Intronic
1030841820 7:114363030-114363052 AAGTATAATACAAAGGTGGGAGG + Intronic
1035119976 7:156559007-156559029 ATTTCTAACAGAGGGGTGGGGGG + Intergenic
1035288594 7:157822494-157822516 ATGGCTAATATATAGGTGGATGG - Intronic
1037422834 8:18722127-18722149 AAGTCTACTAGATCGGTGGGTGG + Intronic
1038076417 8:24080189-24080211 ATGTATAATAGGGAGGTTGGGGG + Intergenic
1038205247 8:25458922-25458944 GCATCCAATAGAAAGGTGGGAGG + Intergenic
1039010816 8:33090847-33090869 ATGACTAATTGAAAGTTGAGGGG + Intergenic
1039486097 8:37911216-37911238 ATTGCTAATATAAAGGTGGAAGG - Intergenic
1039750692 8:40475584-40475606 ATTTTTAAAAGAAGGGTGGGGGG + Intergenic
1039867655 8:41519359-41519381 ATGTCTAATACAAAGCAGAGAGG + Intergenic
1041920656 8:63179668-63179690 TTGTGGAATAGAAAGGGGGGAGG - Intronic
1044550847 8:93510850-93510872 AAGTAAAATGGAAAGGTGGGGGG - Intergenic
1048103801 8:131384845-131384867 ATGTTTAGGAGAAGGGTGGGTGG + Intergenic
1050248909 9:3722916-3722938 ATCTCAAAAAAAAAGGTGGGGGG - Intergenic
1051063644 9:13074774-13074796 CTGTCTAAAAAATAGGTGGGGGG + Intergenic
1054458959 9:65451674-65451696 ATGATGAATGGAAAGGTGGGTGG + Intergenic
1055348999 9:75365847-75365869 ATGTGCAATAGAAATGAGGGTGG + Intergenic
1059739890 9:117139776-117139798 ATGTATAAAGGAAAGCTGGGAGG + Intronic
1060669655 9:125458666-125458688 TTGTGGAATAGAAAGGGGGGAGG - Intronic
1185780546 X:2840701-2840723 ATGGCTAATAGAAAGATGATAGG + Intronic
1185956755 X:4499242-4499264 ATATCTAATAATAAGGTGTGTGG + Intergenic
1187987265 X:24827811-24827833 ACGCCTAAAAGAAGGGTGGGAGG - Intronic
1188518332 X:31011188-31011210 ATGTCTAAATGAAAGGAGAGGGG - Intergenic
1188597650 X:31921093-31921115 ATGTCAAAAATAAAGGTAGGGGG + Intronic
1189280562 X:39817804-39817826 TTGTCTTCTAGAAAGGTTGGGGG + Intergenic
1193434684 X:81458142-81458164 AACTCCAAAAGAAAGGTGGGAGG - Intergenic
1195229517 X:102831950-102831972 ATGTCTAATAATAAGGGGGGTGG + Intergenic
1195772431 X:108365762-108365784 ATTTCTAATAGTCAGGTGTGAGG + Intronic
1195869333 X:109469790-109469812 CTGTGTAAGAGGAAGGTGGGAGG + Intronic