ID: 1074391116

View in Genome Browser
Species Human (GRCh38)
Location 10:113058815-113058837
Sequence AGGAATAAAAGCAGCAACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074391116 Original CRISPR AGGAATAAAAGCAGCAACGC TGG (reversed) Intronic
900479574 1:2891574-2891596 AGGGATCCAAGCAGCACCGCCGG - Intergenic
903797744 1:25942702-25942724 AGGAATGTCAGCAGCAACGCTGG + Intergenic
904091171 1:27945999-27946021 AGGAATTAGAGCAGCAACCTTGG - Intronic
904294285 1:29507672-29507694 TGGACTAAAAGCACCAGCGCTGG - Intergenic
905517232 1:38570761-38570783 AGGACGAAATGCAGCAATGCAGG + Intergenic
906745424 1:48218133-48218155 AGGAAAAAAGGCAGCAAGACTGG + Intergenic
908275632 1:62468062-62468084 ATGATTAAAAGCATCAAGGCCGG + Intronic
911371699 1:97002343-97002365 AGGAAGAAAGGCAGGAAAGCAGG - Intergenic
911371712 1:97002392-97002414 AGGAAGAAAGGCAGGAAGGCAGG - Intergenic
911959638 1:104284741-104284763 AAGAAGAAAAGCAACAACACTGG + Intergenic
915100797 1:153498341-153498363 TGGAAGAAAAGGAGAAACGCAGG - Intergenic
915548809 1:156619772-156619794 TGGAATAAAGGGAGCAACCCAGG - Intronic
916096708 1:161357841-161357863 AAGAATGAAAGCAGCAACAATGG - Intronic
916793887 1:168147756-168147778 AGAAATAAAAGCACCAGGGCCGG + Intergenic
916851330 1:168707196-168707218 AGGATTAAATGCAGTAACACAGG + Intronic
917140357 1:171829086-171829108 TGGTATAAAAGCAGCAACGTGGG + Intergenic
917549874 1:176015199-176015221 AGAGATCAAAGCAGGAACGCAGG + Intronic
917628169 1:176866624-176866646 AGCACTGAAAGCAGCAACGAAGG - Intronic
919436484 1:197568549-197568571 TTGAATAAAAGGAGCAAAGCTGG + Intronic
920061713 1:203231328-203231350 AGGAATAATAGCAGCCACCATGG - Intronic
920089547 1:203442507-203442529 AGGAATAGAAGGAGGAAGGCAGG - Intergenic
920246537 1:204592088-204592110 AGGAATGAATGAAGCAAAGCTGG + Intergenic
920437292 1:205955590-205955612 AGGAAGAAAAGAAGCAAGGAAGG + Intergenic
1065250484 10:23806228-23806250 TGGAATAAACTCAGCAACGGCGG - Intronic
1065363435 10:24911388-24911410 AGGAATGCCAGCAGCAACACAGG - Intronic
1066697341 10:38091007-38091029 AAGAAAAAAAGCAGCAGCCCTGG + Intergenic
1066995196 10:42556464-42556486 AAGAAAAAAAGCAGCAGCCCCGG - Intergenic
1068609665 10:59045089-59045111 AGGAAAAAAAGCAACAACGAAGG - Intergenic
1068860548 10:61843524-61843546 AGGAATAAATGCAGTAACTCAGG - Intergenic
1069591513 10:69645015-69645037 TGGAATAAAAGCAGCCAGGATGG + Intergenic
1069838622 10:71325435-71325457 AGGAATAAAAATACCAATGCGGG + Intronic
1071991147 10:91101924-91101946 ATGGACAAAAGCAGCAATGCTGG + Intergenic
1072271360 10:93780233-93780255 AGGAATAAAAGAAGGAAGGAAGG - Intronic
1072309660 10:94142171-94142193 GGGAATAAAAGCAACAACTTCGG + Intronic
1072635652 10:97176248-97176270 AGGAGTAAAAGAAGGAACTCAGG + Intronic
1073744034 10:106445491-106445513 AGGAATAAAGGCAGGAAGGCAGG + Intergenic
1074391116 10:113058815-113058837 AGGAATAAAAGCAGCAACGCTGG - Intronic
1075865991 10:125719747-125719769 AGGAGCAGCAGCAGCAACGCAGG - Exonic
1076186304 10:128452190-128452212 AGCAAGAAAAGCAGCAAGGCTGG + Intergenic
1078001972 11:7504164-7504186 AGGCATAAAGGCAGCAAGGGAGG + Intronic
1078265215 11:9750374-9750396 AGAGTTAAAAGCAGCAAAGCCGG - Exonic
1079294683 11:19222405-19222427 AGGAATCAAAGCAGCCATGTCGG - Intergenic
1083260152 11:61518382-61518404 AGGAAGAAAAGGGGCAAAGCAGG + Exonic
1084801715 11:71548389-71548411 AGGAAAAACAGCTCCAACGCTGG - Intronic
1086158045 11:83690303-83690325 AGGAATTGAAGAAGCAACACTGG + Intronic
1086856114 11:91868071-91868093 AGGAATGAAGGCAGCAGGGCTGG - Intergenic
1087082305 11:94183384-94183406 AGAAACAAAATCAGCAACCCTGG - Intergenic
1088166679 11:106946547-106946569 AAGAAAAAAAGCAGCAATGGAGG + Intronic
1088841023 11:113627542-113627564 AGGAAGAAAAGAAGGAAGGCAGG + Intergenic
1089711969 11:120321982-120322004 AGGACTCAAAGCAGGAACCCTGG + Intergenic
1089777867 11:120851424-120851446 AGGAATATCAGCAGCAATTCTGG + Intronic
1091370831 11:135056536-135056558 GAGAATAAAAGCTGCAGCGCTGG - Intergenic
1094036567 12:26078260-26078282 AAAAATAAAAGCAGCAAAGAGGG + Intronic
1095164174 12:38952347-38952369 ATGAATACCAGCAGCTACGCTGG + Intergenic
1098455152 12:70664574-70664596 AGTAAGAAAAGCTGCAAAGCAGG + Intronic
1099847503 12:88046690-88046712 AGGAATAAAGGTAGAAAGGCTGG - Intronic
1100402415 12:94243910-94243932 AGGAATAAAAGCAACAATAAGGG - Intronic
1100593258 12:96049258-96049280 AGGAACAAAAGAAGGAACGATGG + Intergenic
1102241040 12:111324983-111325005 AGGATTAAAAGCAGCCATGCTGG + Intronic
1102519554 12:113470113-113470135 AGGAATGAGATCAGGAACGCGGG - Intronic
1104472076 12:129037247-129037269 AGGAATAGAAGGAGCCTCGCTGG + Intergenic
1105394199 13:20013177-20013199 AGGAATAAATGCAGCAAAGGAGG - Intronic
1109642837 13:65212873-65212895 AGGAATAAAAAAAGAAACTCAGG + Intergenic
1110658589 13:78030741-78030763 AAGAATAAACACAGCAACCCTGG + Intergenic
1110985738 13:81965705-81965727 AGGAAAAAAGGCAGGAAGGCAGG - Intergenic
1112203456 13:97301251-97301273 AGGGATAAATGGAGTAACGCAGG - Intronic
1112265071 13:97916145-97916167 AGGAAGAAAACCAGCATAGCTGG + Intergenic
1116522669 14:45869521-45869543 AGGAATAAAAGAAGAAAAGAAGG + Intergenic
1120521131 14:85529775-85529797 AGGAATAAAACCAACTTCGCTGG + Intergenic
1125815558 15:42581087-42581109 TAGAAGAAAAGCAGCAACACTGG - Intronic
1126672351 15:51127825-51127847 AGGAAGACAAGGAGCAATGCAGG + Intergenic
1126870582 15:52982736-52982758 AGGAAGAAAAGCAGGAAAGAAGG - Intergenic
1127634549 15:60857021-60857043 AGGAATGAATGAAGCAACGATGG - Intronic
1128500398 15:68223226-68223248 AGGCAGAAAAGCAGGAAAGCAGG + Intronic
1128746335 15:70116992-70117014 AGGAATGACAGCAGCAATCCAGG + Intergenic
1130579879 15:85126592-85126614 AGGAAAAAAATCATCAACCCAGG - Intronic
1130858404 15:87862861-87862883 ATGAATAACAGCAGCATCACTGG + Intronic
1131488944 15:92845289-92845311 AGAAACAAAAGCAGCAATTCAGG + Intergenic
1132160296 15:99535253-99535275 AGGATTACAGGGAGCAACGCTGG - Intergenic
1133427590 16:5706205-5706227 AGGAAAAAAAGCAACATGGCCGG - Intergenic
1134894934 16:17876897-17876919 AAGATTAAATGAAGCAACGCAGG - Intergenic
1135158185 16:20072193-20072215 AGGAATAAAAGCCTCATCACTGG + Intronic
1136678319 16:31936224-31936246 AAGAATAAAAACTACAACGCAGG + Intergenic
1137241370 16:46657452-46657474 AGGAATAAATGCACCACCACAGG - Exonic
1137666409 16:50252121-50252143 AGGAAAAAAAACAGCAGCCCGGG - Intronic
1138130475 16:54475229-54475251 AGGAAGGAAAGCAGGAAAGCAGG + Intergenic
1141363191 16:83416729-83416751 ATGAATAAAAGCACAAATGCTGG + Intronic
1143574411 17:7782060-7782082 GGGAGTAAAAGCAGGAACCCTGG + Intronic
1144757665 17:17689819-17689841 AGAAATAAAAGCAACAATGGAGG - Intronic
1147718347 17:42522672-42522694 AGAAGGAAAAGCAGCAATGCTGG - Intergenic
1148467877 17:47875593-47875615 AGGCAATGAAGCAGCAACGCTGG + Intergenic
1150204238 17:63389556-63389578 GGGAAGAAAAGCAGCAGAGCTGG - Intronic
1150311843 17:64135381-64135403 AGGAAAAAAAGCAGAGACACAGG - Intergenic
1156534503 18:37849629-37849651 AGGAATAAAGGCAGGAACTCAGG - Intergenic
1157837096 18:50914831-50914853 AGGAAAAAAAGAAGAAACGCAGG - Intronic
1160008397 18:75085599-75085621 AGGAATCACAGCAGCAAGCCCGG + Intergenic
1165962536 19:39547314-39547336 TGGAATAAATGCAGCAATGATGG - Intergenic
1167314906 19:48757531-48757553 AGGAAACAAAACAGCAAGGCAGG - Intronic
925330507 2:3054841-3054863 AGGAAGAATGGCAGCAACACAGG + Intergenic
925369251 2:3332155-3332177 AGAAATAAAAGCAGCAAAGTTGG + Intronic
925614099 2:5729019-5729041 ATGATTAAGAGCAGGAACGCTGG - Intergenic
926841190 2:17082240-17082262 AGGAATAAAAGTAGCAAGATAGG - Intergenic
928381561 2:30822690-30822712 AGGAATAAAAGCAGCAATGTGGG + Intergenic
928756792 2:34536226-34536248 AGGAATAAAAGGAGGAAGGAAGG - Intergenic
930344471 2:50161831-50161853 AGGAATGAAGGCAGGAAGGCAGG + Intronic
930854264 2:55995681-55995703 AAGAAAATAAGCAGCAAAGCTGG + Intergenic
931446927 2:62334496-62334518 AGGAAAACAAGCAGCTATGCTGG - Intergenic
935446934 2:103166997-103167019 ACGAATAAAGGCACCAAGGCAGG - Intergenic
936328235 2:111523859-111523881 AGCCATAAAAACAGCAAAGCAGG + Intergenic
937732872 2:125256107-125256129 AGGAATAAAAGAAGAAAGGCAGG + Intergenic
939138634 2:138326277-138326299 AGGAAGAAAAGAAGGAAGGCAGG + Intergenic
943342978 2:186703482-186703504 GGGAATAAAAGCATGAACACTGG - Intronic
944207945 2:197176591-197176613 AGGAATTATATCAGCAACTCTGG + Intronic
945028958 2:205645829-205645851 AAGAATAAAAGAAGGAACGGAGG + Intergenic
946710059 2:222496329-222496351 ATGAATAAATGCAACAACCCTGG - Intronic
946963186 2:225006698-225006720 AGAAATAAAAGGAGCAAGGAAGG + Intronic
1169311904 20:4549832-4549854 AGGTATAAAAGGAGCAACTAGGG - Intergenic
1169872232 20:10260102-10260124 AGGAATAAAACCATCAGCACTGG - Intronic
1170117445 20:12875643-12875665 TGGAATAAATGCAGCAAAGGAGG - Intergenic
1170308341 20:14964670-14964692 AGTAATAATAGCAGCAACAATGG + Intronic
1170345953 20:15387420-15387442 AGGAATAAAAGGAGAAAGGATGG - Intronic
1170368232 20:15619914-15619936 AGGGACCAAAGCAGCATCGCAGG - Intronic
1170733830 20:18996442-18996464 AGGAAGAAAGGCAGAAAAGCTGG + Intergenic
1171032666 20:21691440-21691462 AGGAATCCAATCAGCAAAGCAGG + Intergenic
1171251689 20:23653670-23653692 AGGAGTTAAAGCAGAAACCCTGG - Intergenic
1172823073 20:37756037-37756059 AGGAATAAAAGCAGAGAGACTGG - Intronic
1172974593 20:38896289-38896311 AGGAAGAAAAGCAGAAAAGGAGG - Intronic
1173289392 20:41701177-41701199 AGGAAAAAAAGCAGTAGCACAGG - Intergenic
1173984150 20:47248094-47248116 AGTAATAAAAACAGAAAAGCAGG - Intronic
1175323378 20:58105472-58105494 AGGCGTAAAAGGAGCAAGGCGGG - Intergenic
1176986919 21:15447622-15447644 AGGAATGAAAGCAGCTACAATGG - Intergenic
1178580271 21:33832161-33832183 ATGAACAAAGGCAGCAAGGCAGG - Intronic
1179395211 21:41033511-41033533 AGGAATAAAAGAAGGAAGGAAGG + Intergenic
1181304021 22:21904147-21904169 AGGATTACAACCAACAACGCGGG - Intergenic
1185178789 22:49347513-49347535 GGGGCTACAAGCAGCAACGCAGG + Intergenic
949515437 3:4803092-4803114 CGGAGTAAAAGCAGCAAAGTTGG + Intronic
949541802 3:5038478-5038500 AGGACTAGAACCAGCAACCCAGG + Intergenic
950234750 3:11308954-11308976 AAGAAGAAAAGCATCAAGGCAGG - Intronic
950724998 3:14911502-14911524 AGGAATGAAAGCAGAAATGCAGG - Intronic
951721594 3:25704477-25704499 AGTAATAAAAGCAGCAGGGAGGG + Intergenic
955520643 3:59772362-59772384 AGGAACATATGCAGCAATGCAGG + Intronic
956999921 3:74873804-74873826 AGCAAAAAAAGCCGCAAGGCAGG - Intergenic
957069107 3:75551708-75551730 AGGACTAAAACAAGCAACTCGGG + Intergenic
957365307 3:79214668-79214690 AGAAATAAAAGCACCAGCACTGG - Intronic
960440360 3:117679459-117679481 TTGAATAAAATCAGCAACACTGG - Intergenic
961722714 3:128907231-128907253 AGGAACAAAAGCAGCCAAGGAGG - Intronic
962200703 3:133399205-133399227 AGAAATAAAAACAACAACGAGGG - Intergenic
962422286 3:135239213-135239235 AGGAATAAAGGCAACCAGGCTGG - Intronic
962843931 3:139259045-139259067 AGGAATAGAAGCAGCAGCTCTGG + Intronic
964076467 3:152698625-152698647 AGAAATAAAAGCATCATCTCTGG - Intergenic
966769746 3:183493125-183493147 AGGAAGAAAAGCTGAAACGGTGG + Intronic
969116852 4:4875649-4875671 AGGAGTAAGAGAAGTAACGCCGG - Intergenic
976207291 4:82635317-82635339 AGCAATAAAAGCAACATCACGGG + Intronic
977021683 4:91768258-91768280 AGGAATAAAAGTATCAAAGTTGG - Intergenic
978971233 4:114808356-114808378 AGGAATCAATGCAGTAACTCTGG + Intergenic
981184577 4:141785862-141785884 AGGAATAGAAACAGTAAAGCAGG + Intergenic
982551438 4:156805579-156805601 AGGAAAAAAAGCAGCATGCCTGG - Intronic
983335690 4:166389000-166389022 AGGAATAAAACCTGGAAAGCAGG - Intergenic
985238070 4:187898554-187898576 AGGAAGAAAAGCAGGAAGGAAGG + Intergenic
988813356 5:34806637-34806659 AGGAATCAAAGCTGAATCGCTGG + Intronic
988971962 5:36477735-36477757 AGGAATAGAAGCAGCATTCCTGG + Intergenic
990948455 5:61273570-61273592 AAGAATGAAAGCAGTAAGGCTGG - Intergenic
992344719 5:75865211-75865233 AGGAATAAAGTCAGAAAGGCTGG + Intergenic
994402692 5:99301366-99301388 AGGAATAAAAAGAACAAAGCTGG + Intergenic
999214568 5:149921317-149921339 AGGAAGGAAAGCAGGAAGGCAGG + Intronic
1001101786 5:168820286-168820308 AGGAACAAAAGCAGAAGAGCAGG - Intronic
1001587214 5:172841200-172841222 AGGAAAAAAACCTCCAACGCTGG + Intronic
1001817129 5:174679026-174679048 AGGAAAAAAAGTAGAAAGGCAGG - Intergenic
1005307829 6:24530797-24530819 AGGTAGAAAAGCAGCAGGGCTGG - Intronic
1005357773 6:25000767-25000789 AACAACAAAAGCAGCAATGCTGG - Intronic
1005528545 6:26677681-26677703 AGGAAAAAAAGCAGCAAGACAGG + Intergenic
1005531387 6:26710126-26710148 AGGAAAAAAAGCAGCAAGACAGG + Intergenic
1005539409 6:26791512-26791534 AGGAAAAAAAGCAGCAAGACAGG - Intergenic
1005955910 6:30663290-30663312 AGGTAAAAAAGCAGGAAGGCTGG + Intronic
1007803936 6:44423107-44423129 AGTAATAAACGCAGTAACACGGG - Intronic
1008457765 6:51731124-51731146 AAGGATTAAAGCAGCAACGCAGG + Intronic
1008597550 6:53058291-53058313 AGAAGTAAAAGCAGCAGCTCAGG - Intronic
1009010233 6:57833689-57833711 AGGAAAAAAAGCAGCAAGACAGG - Intergenic
1009013058 6:57866047-57866069 AGGAAAAAAAGCAGCAAGACAGG - Intergenic
1012310595 6:97719763-97719785 AGGAATAAGTGCAACAACCCAGG - Intergenic
1012452455 6:99367188-99367210 AGGAAGAAAAGGAACAAGGCTGG - Intergenic
1012628504 6:101433347-101433369 AGGTATAAAAGCAGCAAGTCAGG - Intronic
1013576144 6:111484330-111484352 AGGCATAAAAGCACCACCGTGGG + Intergenic
1015262174 6:131250573-131250595 AGAAAGGAAAGCAGCAAAGCTGG - Intronic
1015776643 6:136821480-136821502 AGGAATAACATGAGCAACCCAGG - Intergenic
1017689443 6:156948543-156948565 AGGCATAAATGCAGCAACTATGG - Intronic
1021221792 7:17983202-17983224 AGGAAGAAAAGAAGCAGCTCAGG - Intergenic
1022405134 7:30082249-30082271 AGAGAGAAAAGCAACAACGCTGG - Exonic
1027568192 7:79825980-79826002 AGGAATAAAAGCAGTGACAGTGG + Intergenic
1027801646 7:82759753-82759775 AGGAATAAAAGTAGAAATGGGGG - Intronic
1030300316 7:107967995-107968017 AGGAATAACAGGAGCAAAGAGGG + Intronic
1030484297 7:110147213-110147235 AGGAATAAAAGGAGAAAAGGAGG - Intergenic
1030968192 7:116020038-116020060 AGGATTAAATGAAGCAAGGCAGG - Intronic
1031132499 7:117848817-117848839 AGGAATAAAAACAGCAAAATGGG - Intronic
1034105886 7:148489509-148489531 AGGAATAAAAGCAGAAAGGCAGG + Intergenic
1035028259 7:155841156-155841178 AGGAATAAAAGTGTCAACACAGG - Intergenic
1036203944 8:6791732-6791754 AGGAGAAAAATCAGCAAGGCAGG - Intergenic
1038052213 8:23824709-23824731 AGGAATAAAAGTGGGAAGGCAGG - Intergenic
1040109819 8:43562329-43562351 GGGAAAAAAAGCAGCAAGGCAGG - Intergenic
1041967834 8:63701158-63701180 AGGAAGAAAATCAGCAAAGAAGG + Intergenic
1044386509 8:91595250-91595272 AGAAACAAAAGCAGCAGGGCCGG + Intergenic
1044600271 8:93996757-93996779 AGGAATAAAAGCAGGCAAGAAGG + Intergenic
1047756687 8:127924199-127924221 AGGAATAACACCAGCAATGATGG - Intergenic
1050354356 9:4769201-4769223 AGTAATAATGGCAGCAATGCAGG + Intergenic
1051400275 9:16673850-16673872 GGGAACTAAAACAGCAACGCTGG - Intronic
1053114283 9:35488480-35488502 AGGAACAAAAGAAGGAAAGCAGG + Intergenic
1053611229 9:39715010-39715032 AGGAGTTAAAGCAGCAAAGGGGG - Intergenic
1054087025 9:60756148-60756170 AGGAGTTAAAGCAGCAAAGGGGG + Intergenic
1054242291 9:62627380-62627402 AGGAGTTAAAGCAGCAAAGGGGG + Intergenic
1054556416 9:66661898-66661920 AGGAGTTAAAGCAGCAAAGGGGG + Intergenic
1055718609 9:79146310-79146332 AGGAATGAAGGCAGCCAGGCAGG + Intergenic
1057133156 9:92668875-92668897 AGGAACAACAGAAGCAAGGCAGG + Intronic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1058650989 9:107175718-107175740 AGAAACAAAAGCAGCTAGGCTGG + Intergenic
1058753052 9:108058210-108058232 AGGTATGAAAACAGCAAAGCCGG + Intergenic
1059365640 9:113784586-113784608 AGGAAGAGAAGGAGCAACACTGG + Intergenic
1060832628 9:126726888-126726910 AGGAATAAAAGGAGAAAGGAAGG - Intergenic
1186980288 X:14951250-14951272 ATGAATAAAATCAACAACACAGG + Intergenic
1187102992 X:16214183-16214205 AGAAATAAAAGCACAAACGAAGG - Intergenic
1187817852 X:23252321-23252343 AACAAAAAAAGCAGCAATGCGGG - Intergenic
1189394163 X:40605224-40605246 AAGAATATCAGCAGCAAGGCTGG - Intronic
1191190163 X:57658069-57658091 TGGAATATAAGCAGCACCGCAGG + Intergenic
1192052394 X:67736703-67736725 AGAAATGAAAGCAGGAACCCTGG + Intergenic
1192327548 X:70145730-70145752 AGGAATAAAAGCAAATACGAGGG - Intronic
1193880571 X:86916149-86916171 AGGAAGAAAGGAAGCAACGAAGG + Intergenic
1194317388 X:92396868-92396890 AGAGATAAAAGCAGGAAAGCAGG - Intronic
1197334527 X:125195996-125196018 AGGAAGAAAAGAAGGAACGAAGG + Intergenic
1198099496 X:133412554-133412576 GGAAATAAAAGCAGCAGCCCAGG + Intronic
1198800016 X:140439192-140439214 AAGAATAAAAGCAGCAACATCGG - Intergenic
1199672924 X:150161753-150161775 AGGATTAAAAGAAGCAATGGAGG - Intergenic
1200625564 Y:5510178-5510200 AGAGATAAAAGCAGGAAAGCAGG - Intronic
1201485097 Y:14485626-14485648 AGGAAGAAAGGAAGCAAGGCAGG + Intergenic
1201764587 Y:17565708-17565730 GGGGATAAAAGCAGCGAGGCTGG - Intergenic
1201836966 Y:18340282-18340304 GGGGATAAAAGCAGCGAGGCTGG + Intergenic
1202084409 Y:21120806-21120828 AGGAAGAAAAGGAGCATCCCAGG - Intergenic