ID: 1074392485

View in Genome Browser
Species Human (GRCh38)
Location 10:113069681-113069703
Sequence CTACATACACAGTCTCTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074392485_1074392488 14 Left 1074392485 10:113069681-113069703 CCATTCAGAGACTGTGTATGTAG 0: 1
1: 0
2: 0
3: 9
4: 128
Right 1074392488 10:113069718-113069740 ATTCATTGAGGGCCCCTCGCTGG No data
1074392485_1074392487 3 Left 1074392485 10:113069681-113069703 CCATTCAGAGACTGTGTATGTAG 0: 1
1: 0
2: 0
3: 9
4: 128
Right 1074392487 10:113069707-113069729 GTGTACAGTGTATTCATTGAGGG No data
1074392485_1074392486 2 Left 1074392485 10:113069681-113069703 CCATTCAGAGACTGTGTATGTAG 0: 1
1: 0
2: 0
3: 9
4: 128
Right 1074392486 10:113069706-113069728 AGTGTACAGTGTATTCATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074392485 Original CRISPR CTACATACACAGTCTCTGAA TGG (reversed) Intronic
901454909 1:9357708-9357730 CTGCATTCACAGTCTGAGAAAGG - Intronic
905401170 1:37704509-37704531 ATACATACAAAGTTTCTGGAAGG + Intronic
915987989 1:160485533-160485555 CTACATAGAGAGTGTCAGAAGGG + Exonic
917980021 1:180263409-180263431 CTAGATACACTGGCTCTGACTGG + Intronic
919675868 1:200382432-200382454 CTACAGAGACAGTATCTGAAGGG - Intergenic
920567439 1:206985995-206986017 CTGCCTAGACTGTCTCTGAAGGG - Intergenic
920965114 1:210694811-210694833 CTGCATAAAGAGTGTCTGAATGG - Intronic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1063539966 10:6922560-6922582 CTATCTACATAGTCTCTCAAAGG - Intergenic
1064159005 10:12927899-12927921 CTACATACACAGTCCAGAAATGG + Intronic
1065155273 10:22863091-22863113 CCAAATACACAGACTCTAAAAGG - Intergenic
1066512356 10:36115710-36115732 GAACATACACAGCCACTGAAGGG - Intergenic
1068656287 10:59579279-59579301 AAACATAAAAAGTCTCTGAAAGG - Intergenic
1068768866 10:60798193-60798215 CTAAATACACATTCTCTTTAGGG - Intergenic
1070228611 10:74539546-74539568 CTATATGCACAGTCTCAGAAAGG - Intronic
1071923167 10:90374466-90374488 CTTCAATCACAGTGTCTGAATGG + Intergenic
1074392485 10:113069681-113069703 CTACATACACAGTCTCTGAATGG - Intronic
1075791414 10:125086962-125086984 CCACACACACGATCTCTGAATGG + Intronic
1081438328 11:43053224-43053246 GTACATACACAGACCCTGAATGG - Intergenic
1081438682 11:43056752-43056774 CTATATACACAGTATTTTAAAGG - Intergenic
1083592118 11:63901984-63902006 TGACAAACACAGTCTCAGAAAGG - Intronic
1086165588 11:83774213-83774235 CTGCATCCACAGTCTCCCAAGGG + Intronic
1086493573 11:87379730-87379752 TTACATACAAAGACTCTTAATGG + Intergenic
1087183956 11:95166712-95166734 ACACATACACAGTCTCAGCAAGG - Exonic
1087301671 11:96443234-96443256 CTACTTACACTCTCTCTAAATGG + Intronic
1087309680 11:96526645-96526667 CTACATACTCTGCCACTGAACGG + Intergenic
1089899043 11:121962276-121962298 GCACATCCACAGTCCCTGAATGG - Intergenic
1092213788 12:6666249-6666271 CTACATACACATTCTGTCATGGG - Intergenic
1092228772 12:6765830-6765852 CTCCATCCACATTCTCTGGATGG - Intronic
1100669094 12:96790414-96790436 CTACATATATAGTATTTGAAAGG + Intronic
1101042318 12:100768834-100768856 CTACACCCACACTCCCTGAAAGG - Intronic
1106052086 13:26200823-26200845 CTGCAAACACTGTATCTGAATGG - Intronic
1107789861 13:43990816-43990838 CTAGATACACACTATTTGAATGG + Intergenic
1111076028 13:83236637-83236659 GTACATATACAGACGCTGAATGG + Intergenic
1112168548 13:96946278-96946300 CTGCATACTGAGTCTCTCAATGG - Intergenic
1113881290 13:113628240-113628262 CTTCAGACACAGTCTCTACACGG - Intronic
1116124759 14:40769746-40769768 TTACATAAACATTTTCTGAAAGG + Intergenic
1116773514 14:49153546-49153568 CTCTAAACACAGTCTCAGAAAGG + Intergenic
1117437304 14:55728892-55728914 ATACTTACACAGTTGCTGAAAGG + Intergenic
1118085599 14:62412434-62412456 CCAGATACATGGTCTCTGAAAGG + Intergenic
1119572031 14:75683236-75683258 CTTCATACTCAGTTTCTGCAAGG + Intronic
1120221411 14:81738194-81738216 CCAGATACAGAGTCTCTGACAGG - Intergenic
1120263332 14:82216638-82216660 CAACACTCACAGTCTCTGAAAGG - Intergenic
1120875333 14:89370294-89370316 CTACAAAAATGGTCTCTGAAAGG + Intronic
1124445275 15:29725336-29725358 AGACATACACAGCCTCTGCAAGG - Intronic
1126385326 15:48088161-48088183 CTGCATACACAGACCCTGAGTGG - Intergenic
1128390876 15:67181524-67181546 CTGAACACACAGCCTCTGAAGGG + Intronic
1138173029 16:54870816-54870838 CTACATACACCTTCTTTGAAAGG + Intergenic
1139942487 16:70615536-70615558 AAAGATACACTGTCTCTGAAAGG + Intronic
1140221246 16:73046107-73046129 ATAGCTACACACTCTCTGAAAGG + Intronic
1148753310 17:49958581-49958603 CTAGATACAGAGTCTGTGTAGGG - Intergenic
1150185193 17:63173235-63173257 CTACACACTCAGTCTCTCAAAGG - Intronic
1150194018 17:63275280-63275302 CTAAACACAAAGCCTCTGAATGG - Intronic
1158824834 18:61206038-61206060 GCACATACACAGGATCTGAATGG - Intergenic
1162390838 19:10389137-10389159 CAACATACACAGTGCCAGAAAGG - Intergenic
1168679424 19:58303443-58303465 GTACACACATAATCTCTGAAAGG + Intronic
926198767 2:10778777-10778799 CAACAGCCACAGTCTCAGAAAGG - Intronic
926499168 2:13631583-13631605 CAAAATACTCAGTGTCTGAAAGG + Intergenic
927866963 2:26595289-26595311 CTGCAGATACGGTCTCTGAAAGG + Exonic
929205151 2:39283098-39283120 CTACTTACACAGTGTATGAGTGG + Intronic
929441712 2:41970402-41970424 CTACATATACCCTCTCTGCATGG + Intergenic
930882461 2:56287671-56287693 CTGTAAACACTGTCTCTGAAAGG - Intronic
932024179 2:68116806-68116828 CTGCTGACACAGTCTCTGTAAGG - Intergenic
932308754 2:70723114-70723136 CTACAAATCCAGGCTCTGAATGG + Intronic
936703338 2:115040138-115040160 GTATTTACACAGTCTTTGAACGG - Intronic
944235513 2:197438183-197438205 CTACATACACCCACTCTGATAGG + Intergenic
946493925 2:220176466-220176488 CTACATACACATTATCAGAGTGG - Intergenic
946765342 2:223035530-223035552 CTACACACACAGACACTTAAGGG + Intergenic
948736109 2:240006209-240006231 CCACCTAAACAGTCTCTCAAAGG + Intronic
1173032893 20:39378789-39378811 CTCTATAAACAGTCTTTGAAAGG + Intergenic
1173270076 20:41525817-41525839 CTGCATACAGAGTAGCTGAAAGG - Intronic
1174462511 20:50692509-50692531 GCACACACACAGACTCTGAAGGG + Intergenic
1175460293 20:59147298-59147320 TTCCATGCACAGGCTCTGAAGGG + Intergenic
1177875683 21:26628238-26628260 TGCCATACACAGTCTCTCAAAGG + Intergenic
1179229516 21:39488837-39488859 CTAGATACACAGTGTCTCACAGG - Intronic
1179794619 21:43775910-43775932 CTGCATGGACAGTCTCTGAGAGG - Intronic
1181506166 22:23359411-23359433 CAACATTCCCAGACTCTGAAAGG + Intergenic
1181683255 22:24510695-24510717 CAACATGCACAGCCTCTGAGGGG - Intronic
1183025844 22:35065560-35065582 TTACATTCACAGTCTCTGCCAGG + Intergenic
1183084123 22:35475924-35475946 CTACTAACATAGTTTCTGAAAGG - Intergenic
950111852 3:10423730-10423752 CTGCATCCACTGCCTCTGAAAGG - Intronic
951918459 3:27826803-27826825 CAACATAGACAGACTCTGTAGGG + Intergenic
958484979 3:94693832-94693854 CTTCATACTGTGTCTCTGAATGG + Intergenic
959359546 3:105370224-105370246 CTACATCAATAGTCTTTGAAAGG - Intronic
960304906 3:116049489-116049511 CTACAAACACAGAGTTTGAAAGG - Intronic
960853796 3:122082295-122082317 ATACATACACTGTTGCTGAAGGG - Intronic
968178551 3:196572251-196572273 AAACAAACACAGTCTCTTAATGG + Intronic
969265875 4:6063824-6063846 CCACATCCCGAGTCTCTGAATGG - Intronic
973856929 4:55020933-55020955 CTACAACCCAAGTCTCTGAAAGG - Intergenic
974407910 4:61499371-61499393 ATACATTCACATTCTCTGCATGG + Intronic
976354665 4:84103305-84103327 CTAGATAGATAGTATCTGAAAGG + Intergenic
987128121 5:14834292-14834314 GTAAATGCTCAGTCTCTGAATGG + Intronic
990491797 5:56310053-56310075 CTACAGACTCATTCTTTGAATGG - Intergenic
992347031 5:75889742-75889764 CTTCATACACATCCACTGAATGG + Intergenic
993389308 5:87298547-87298569 CTAACTACTCATTCTCTGAAAGG - Intronic
999816452 5:155181677-155181699 CTCCACAGACAGCCTCTGAAGGG + Intergenic
999943807 5:156573654-156573676 CTAGATACACATTCTATGAAGGG + Intronic
1001972780 5:175969671-175969693 TTACTTACACTGTCTCTGGAAGG - Intronic
1002244658 5:177874111-177874133 TTACTTACACTGTCTCTGGAAGG + Intergenic
1003012310 6:2437197-2437219 CCACATACACAGTCCATAAAGGG - Intergenic
1003089422 6:3089039-3089061 AAACATACAGAGTCTCTGAAAGG - Intronic
1004226431 6:13788864-13788886 CTACACAAACATTCTCTAAAAGG + Exonic
1004710377 6:18164629-18164651 CTAAATACAAAGACTCAGAAAGG - Intronic
1004881012 6:20008525-20008547 CTCCACAGACAGTGTCTGAAGGG + Intergenic
1007301019 6:40868000-40868022 TTACAGACACAGACCCTGAAGGG - Intergenic
1008205811 6:48654725-48654747 CTACATAAAAAGATTCTGAATGG - Intergenic
1009450445 6:63793860-63793882 CTACATACAAAGGCTCTAAGCGG - Intronic
1009850489 6:69191901-69191923 TTACATAAACAGTCACTTAACGG - Intronic
1010283503 6:74047737-74047759 CTACATATACTGTCAATGAATGG - Intergenic
1014915168 6:127137647-127137669 ATACATACATAATATCTGAAAGG - Intronic
1016794944 6:148107895-148107917 CTACATCCACAGTATCTGTGTGG + Intergenic
1017619027 6:156275954-156275976 CTACACACCCAGTGCCTGAAAGG + Intergenic
1018116756 6:160593798-160593820 CTTCAGGCACAGTGTCTGAAAGG - Intronic
1018130460 6:160726547-160726569 CCTCATAGACTGTCTCTGAAGGG - Intronic
1018289661 6:162278998-162279020 CTTCATACTCAGTCACTAAATGG + Intronic
1023716440 7:43048700-43048722 CAAAAGACACAGTTTCTGAATGG + Intergenic
1026452529 7:70541869-70541891 CTACATATGCAGTGTTTGAAAGG + Intronic
1026455052 7:70564286-70564308 CTCCATGCTCAGTGTCTGAAGGG + Intronic
1033314246 7:140284505-140284527 CTCAATACATATTCTCTGAATGG + Intergenic
1037318044 8:17617446-17617468 GTACAGACACTGGCTCTGAAGGG + Intronic
1041820862 8:62031513-62031535 CTTGATTCACAGTTTCTGAAAGG + Intergenic
1046547759 8:115673077-115673099 ATACACACACAATCTCTGACCGG + Intronic
1046827601 8:118708635-118708657 AAAAATACACAGCCTCTGAATGG + Intergenic
1048205599 8:132412790-132412812 CCACATACAATGTCTATGAATGG + Intronic
1050083716 9:1942045-1942067 ATTCATACACGGTCTTTGAAGGG - Intergenic
1053390354 9:37730685-37730707 ATACATAAACTGTCTCTGGAAGG + Intronic
1055420287 9:76133309-76133331 GTATATACATAGTCTATGAAAGG + Intronic
1055553710 9:77454632-77454654 CTAAAGAAACAGTCTCAGAATGG - Intronic
1055896580 9:81183857-81183879 AAACAAACACAGTCTCTGACAGG - Intergenic
1056301295 9:85244488-85244510 CCACATAAAAAGTCTTTGAATGG - Intergenic
1059492386 9:114679694-114679716 CTTCTTACACAGAGTCTGAAGGG + Intergenic
1188099609 X:26067941-26067963 CAAAATCCACAGTCTATGAAGGG + Intergenic
1191586421 X:62832112-62832134 CCAAAAGCACAGTCTCTGAAAGG + Intergenic
1192083016 X:68066394-68066416 CCACATACACAGCCTCAGAGAGG + Intronic
1195830308 X:109050430-109050452 CTACAACCACAGTCGCTAAAAGG - Intergenic
1199250929 X:145660503-145660525 CTTCCTACACAGTCTGTGGAAGG + Intergenic
1201614651 Y:15883866-15883888 ATACCTACACAGTTTCTGGATGG - Intergenic
1201686078 Y:16703838-16703860 CTACATACACAGCCTAAGAATGG - Intergenic