ID: 1074394443

View in Genome Browser
Species Human (GRCh38)
Location 10:113085991-113086013
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074394431_1074394443 18 Left 1074394431 10:113085950-113085972 CCAGTGGCGGTGACAGGGACACT 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1074394443 10:113085991-113086013 TTGGGGCAATTCCAGCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr