ID: 1074394993

View in Genome Browser
Species Human (GRCh38)
Location 10:113090369-113090391
Sequence CACATAGCACAGCACCCAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 154}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074394993_1074394998 26 Left 1074394993 10:113090369-113090391 CCTATTGGGTGCTGTGCTATGTG 0: 1
1: 0
2: 3
3: 21
4: 154
Right 1074394998 10:113090418-113090440 GCCTCCAGCAGGCAGAGACCTGG No data
1074394993_1074394994 -10 Left 1074394993 10:113090369-113090391 CCTATTGGGTGCTGTGCTATGTG 0: 1
1: 0
2: 3
3: 21
4: 154
Right 1074394994 10:113090382-113090404 GTGCTATGTGTTACAGCCACAGG No data
1074394993_1074394997 15 Left 1074394993 10:113090369-113090391 CCTATTGGGTGCTGTGCTATGTG 0: 1
1: 0
2: 3
3: 21
4: 154
Right 1074394997 10:113090407-113090429 CAGAAAGCAGTGCCTCCAGCAGG No data
1074394993_1074394995 -9 Left 1074394993 10:113090369-113090391 CCTATTGGGTGCTGTGCTATGTG 0: 1
1: 0
2: 3
3: 21
4: 154
Right 1074394995 10:113090383-113090405 TGCTATGTGTTACAGCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074394993 Original CRISPR CACATAGCACAGCACCCAAT AGG (reversed) Intronic
900934443 1:5756266-5756288 CCCACAGCACAGCACCCAGATGG + Intergenic
901894581 1:12299976-12299998 CAGATAGCATAGTACCCAATAGG + Intronic
901907731 1:12428788-12428810 CACAGCGCCCAGCACCTAATTGG - Intronic
902098213 1:13963892-13963914 CAGATAGCACAGCTGGCAATTGG - Intergenic
904476153 1:30765891-30765913 CACAGAGCACGGCAGCCAAGAGG + Intergenic
905627225 1:39497260-39497282 AACATCGCACAGCTCCCAAATGG - Intronic
906952812 1:50348542-50348564 CACAGAGCCCAGCACCGAGTGGG - Intergenic
907053135 1:51343169-51343191 CCCAGAGCACAGCACATAATGGG - Intronic
909146547 1:71940671-71940693 CAAATAGCATCTCACCCAATGGG - Intronic
911726562 1:101247371-101247393 CACCTAGCACAGTTCACAATAGG - Intergenic
913612233 1:120519607-120519629 CACACAGCACAGCACCAATCAGG + Intergenic
913692274 1:121290475-121290497 CACAGAGCACAGTACTCAGTAGG - Intronic
914145281 1:144989639-144989661 CACAGAGCACAGTACTCAGTAGG + Intronic
915633743 1:157172211-157172233 CACACAGCACAACACACAACAGG - Intergenic
915637568 1:157197165-157197187 CACACAGCACAACACACAACAGG - Intergenic
915658007 1:157377514-157377536 CACACAGCACAACACACAACAGG - Intergenic
916884568 1:169054492-169054514 CACAGAGCATAGCACCAAGTAGG + Intergenic
919047886 1:192476178-192476200 CACATAGCACCCCTCCCAACAGG - Intergenic
920479598 1:206308824-206308846 CACAGAGCACAGTACTCAGTAGG - Intronic
921554216 1:216577541-216577563 AACAGTGCACAGCACCCCATGGG + Intronic
1063531567 10:6838235-6838257 GACATAGCACAGCACTGACTTGG - Intergenic
1064086051 10:12347772-12347794 AACATAGCAGAGAACCAAATAGG + Intergenic
1064775666 10:18773814-18773836 TACATAGCAAAGGACCCAAATGG + Intergenic
1068705666 10:60072772-60072794 CACAGAGCAAAGCACCAGATGGG - Exonic
1071902981 10:90140769-90140791 CACCCCGCACAGCCCCCAATTGG - Intergenic
1071913058 10:90257597-90257619 CAGTGAGCACAGCACCCAATTGG - Intergenic
1073618936 10:105026866-105026888 CAGGGAGCATAGCACCCAATAGG - Intronic
1074394993 10:113090369-113090391 CACATAGCACAGCACCCAATAGG - Intronic
1074543413 10:114384740-114384762 CACAGGGCACAGCCCCCAGTAGG - Intronic
1076333874 10:129692048-129692070 CACAGTGCCCAGCACCCAGTGGG + Intronic
1076604323 10:131679369-131679391 CTCAAAGCACAGGATCCAATAGG + Intergenic
1076811653 10:132889378-132889400 CACAGATCCCAGCATCCAATGGG - Intronic
1078071341 11:8113520-8113542 CACATAGCCCAGTGCCAAATTGG + Intronic
1078268059 11:9769760-9769782 CACACAGCACAGCACTTAACTGG + Intergenic
1079530246 11:21443699-21443721 CACATACCACCACACCCAAGTGG - Intronic
1080096799 11:28418007-28418029 CACAGAGCCCTGCACTCAATAGG - Intergenic
1081743531 11:45457400-45457422 CACACAGGACAGCAGCCAAGTGG + Intergenic
1083004073 11:59324812-59324834 CAGTGAGCACAGAACCCAATAGG + Intergenic
1084912527 11:72402503-72402525 AAAATAGCACAGCCTCCAATGGG + Intronic
1084951473 11:72668558-72668580 CACACAGCCCAGCACCCACCAGG + Intronic
1086866778 11:91989331-91989353 CACAGAGCATAGTGCCCAATAGG - Intergenic
1088567612 11:111189135-111189157 CATTAAGCACAGTACCCAATAGG - Intergenic
1093446284 12:19262762-19262784 CAGATAGCACAGTACCCAGTTGG - Intronic
1094392386 12:29965694-29965716 CAAATAGCATAGCACCCACTAGG - Intergenic
1097414255 12:59295115-59295137 CAATTAGCACAACACCTAATAGG - Intergenic
1100849291 12:98692511-98692533 CAGATAGCATAGTACCCAATAGG + Intronic
1101292401 12:103384735-103384757 CACAGAACATAGCACACAATAGG + Intronic
1102585126 12:113917503-113917525 AACATAGCACAGACCACAATGGG + Intronic
1102669864 12:114608994-114609016 CACGTATCACAGTAGCCAATAGG - Intergenic
1102694263 12:114785836-114785858 CACAGTGAACAGGACCCAATAGG - Intergenic
1103143425 12:118572393-118572415 TACTGAGCACAGTACCCAATAGG + Intergenic
1105971838 13:25436223-25436245 CAGTGAGCACAGCACCCAGTAGG + Intronic
1106809529 13:33346409-33346431 CACATGGCACAGAAACCCATAGG + Intronic
1112138153 13:96606651-96606673 CATTGAGCACAGCACCCAATAGG - Intronic
1113344791 13:109466818-109466840 CACATACCACAGCTCCCACAAGG + Intergenic
1116129161 14:40832086-40832108 CACTAAGCATAGTACCCAATAGG + Intergenic
1118388369 14:65275897-65275919 CACATAAGACAGCACACAAAAGG - Intergenic
1119607058 14:76028571-76028593 CAGTGAGCACAGTACCCAATAGG + Intronic
1126391913 15:48166599-48166621 CACATTTAACAGCACCCAGTTGG + Intronic
1127113761 15:55702992-55703014 AACATAGCACAGAATCCACTAGG + Intronic
1129892236 15:79078897-79078919 CACATAGCATGGCACCCAGGAGG - Intronic
1131664036 15:94550652-94550674 CACATAGCCCAGCCCTCCATTGG - Intergenic
1136125378 16:28175624-28175646 CACCTAGTACAGCACCTAACAGG + Intronic
1138609611 16:58112206-58112228 CATATAGGACACCACCTAATAGG + Intergenic
1145015298 17:19392556-19392578 CATATTCCACAGCACCCACTCGG - Intergenic
1155168403 18:23249170-23249192 CACATATCAGAGCATCCAATAGG + Intronic
1155226703 18:23735617-23735639 CACAGAGCACAGCACACAGTAGG - Intronic
1156355841 18:36339334-36339356 CTCATAGCCCAGAACCCAACAGG + Intronic
1156649176 18:39203864-39203886 CACATAGCCCATCTCCCAAATGG - Intergenic
1157747010 18:50144778-50144800 CACCTAACATAGCACCTAATAGG + Intronic
1160787350 19:907217-907239 CACAGAGCACAGCAGCCGACGGG + Intronic
1162667146 19:12223459-12223481 CAGTGAGCACAGCACCCAACAGG - Intergenic
1163025832 19:14511397-14511419 ATCATAGAACAGCACTCAATAGG - Intergenic
1163373397 19:16914983-16915005 CACATTGCCCAGCACCCAGTGGG + Intronic
1163416082 19:17187284-17187306 GACAAAGCCCAGCACCCCATGGG - Intronic
1164661448 19:29974690-29974712 CAGATAGCATAGTACCCAGTAGG + Intronic
1165560854 19:36678422-36678444 CACATAGCAAAGGAAACAATAGG + Intergenic
928263218 2:29786583-29786605 CACCCAGCACAGTACACAATTGG - Intronic
928649860 2:33392570-33392592 TAGATAGCACAGCAGCAAATGGG + Intronic
929625487 2:43402639-43402661 TACCTAGCACAGCACACACTTGG + Intronic
930085882 2:47496957-47496979 CACATAGAACAGCACAGAAGTGG - Intronic
931196397 2:60055947-60055969 CACAGAGCTCGGCACCCACTAGG - Intergenic
931404180 2:61960587-61960609 CAAATAACACTGCCCCCAATGGG - Intronic
934759924 2:96849058-96849080 CACAGTGCACAGCACCCTCTAGG - Intronic
936166665 2:110126558-110126580 CCCATAGCACAGCAGTTAATAGG - Intronic
936174034 2:110203297-110203319 CAGTGAGCACAGTACCCAATAGG - Intronic
940496014 2:154429673-154429695 TAGATAAAACAGCACCCAATTGG + Intronic
943191989 2:184689094-184689116 CACATAACACAGAACCTAGTGGG - Intronic
943778455 2:191794179-191794201 CACCAAGCACAGGACCCACTGGG - Intergenic
946827947 2:223698237-223698259 AACAAAGCAGAGCACCCACTTGG + Intergenic
948804185 2:240446310-240446332 CACCCAGAACAGCACCCAGTAGG - Intronic
1175307740 20:57988874-57988896 GTCACAGCACAGGACCCAATAGG - Intergenic
1175673357 20:60926026-60926048 CAGTGAGCACAGCACCCAAAGGG + Intergenic
1177247460 21:18547201-18547223 CAAATATGACAGCACTCAATGGG - Intergenic
1179083570 21:38196122-38196144 CCCATACAACAGCAGCCAATGGG + Intronic
1182442596 22:30372924-30372946 CACAGAGAACAGCACCCACTTGG - Intronic
1182920743 22:34076722-34076744 CACCTGGCACAGCACAAAATAGG + Intergenic
1183983296 22:41555230-41555252 CCCAGAGCACAGGACCCTATAGG - Intergenic
1185277365 22:49955571-49955593 CACGTCCCACAGCACCCAGTGGG - Intergenic
949566412 3:5249156-5249178 CAGTGAGCACAGCACCCAATAGG - Intergenic
949687073 3:6587882-6587904 CAGTGAGCACAGTACCCAATAGG - Intergenic
950952292 3:17013189-17013211 CACACACCACAGCAGCCACTGGG - Intronic
951721764 3:25707070-25707092 TACTTAGCACAGCACCCAAGAGG - Intergenic
952058204 3:29474570-29474592 CACAAAACACAGCACAAAATAGG - Intronic
954390526 3:50265935-50265957 GACAGGGCACAGCACTCAATGGG + Intergenic
954864475 3:53717341-53717363 CACACAGCACTGCACCCACCTGG - Intronic
956943258 3:74189500-74189522 TAATAAGCACAGCACCCAATAGG + Intergenic
961746002 3:129063873-129063895 CAAATAGAACATCAGCCAATTGG + Intergenic
962955115 3:140258564-140258586 TACATATCACAGCAGCAAATGGG - Intronic
963454902 3:145533354-145533376 CAGTAAGCACAGTACCCAATAGG + Intergenic
963945495 3:151141451-151141473 CAAACAGCACAGCCCCCATTTGG - Intronic
964698609 3:159537924-159537946 TACATAGTACAGAAGCCAATAGG + Intronic
968459725 4:718577-718599 CACAGAGCACAGCACTCACACGG - Intronic
969059146 4:4421290-4421312 CACATCACACAGCAACCAAGTGG + Intronic
969498093 4:7537485-7537507 CACACAGCCCAGCACCTAGTAGG - Intronic
969875008 4:10129719-10129741 CACATAGCACAGCTGCCAGCTGG - Intergenic
970440102 4:16073454-16073476 TACATTGCAAAGCACCCAGTGGG + Intronic
972983391 4:44733014-44733036 CACTAAGCATAGAACCCAATAGG - Intergenic
978378460 4:108100796-108100818 CACATATAACAGCACCCCACTGG + Intronic
978718399 4:111874455-111874477 CAGTGAGCATAGCACCCAATAGG + Intergenic
979207162 4:118052425-118052447 CAGTAAGCACAGTACCCAATAGG - Intronic
979927210 4:126582732-126582754 AACATACCCCAGCACCCACTAGG + Intergenic
982810036 4:159813744-159813766 CACATAGCAGAGTCCCCAAGTGG - Intergenic
985963955 5:3325393-3325415 CACATACCACAGCAACCTACTGG + Intergenic
988699348 5:33657941-33657963 CACATATCACAGAACCAAATAGG - Intronic
989998115 5:50859778-50859800 CAGATAGCATAGCAACCAAGTGG - Intergenic
993779247 5:92045310-92045332 CAATGAGCATAGCACCCAATAGG + Intergenic
994920301 5:106033941-106033963 CAGAAAGCACAGCAACTAATTGG - Intergenic
995387715 5:111606770-111606792 TAGAGAGCACAGTACCCAATAGG + Intergenic
996772697 5:127101679-127101701 AACATAGGACAGCATCCAAAAGG - Intergenic
997698672 5:135881037-135881059 CACAGAGCCCAGCACACAAAGGG + Intronic
998483625 5:142483354-142483376 CACATAACACAGCAGCCCCTGGG - Intergenic
1000130671 5:158294939-158294961 CATAAACCACAGCACCGAATTGG + Intergenic
1010278529 6:73996967-73996989 CAGTGAGCACAGCACCCAATAGG + Intergenic
1012435823 6:99214364-99214386 TACAGAGCATAGTACCCAATAGG - Intergenic
1017033568 6:150246424-150246446 CACATAACACAGGAGGCAATAGG + Intronic
1021189091 7:17600047-17600069 TACATAGCACAGCACAGAATGGG - Intergenic
1021536079 7:21706134-21706156 CACCTAGCACAGCACATAATAGG - Intronic
1023956342 7:44889800-44889822 CACACACCACTGCACCCAGTTGG + Intergenic
1025159606 7:56643580-56643602 TAGATAGCACAGCACCCAATAGG + Intergenic
1025756070 7:64343448-64343470 TAGATAGCACAGTACCCCATAGG - Intronic
1028163085 7:87508019-87508041 TACTGAGCACAGAACCCAATAGG - Intronic
1029514071 7:101015207-101015229 CACAGAGCACAGCACCACATGGG + Intronic
1033584851 7:142766674-142766696 AACTGAGCACAGTACCCAATAGG + Intergenic
1034398036 7:150842265-150842287 CCCAAAGCACTGCAGCCAATGGG - Intronic
1035670755 8:1415417-1415439 CACTGAGCACAGCACCCAATGGG + Intergenic
1035700714 8:1637819-1637841 CACATCTCACAGCACCCAGCAGG - Intronic
1035715884 8:1754665-1754687 CTCATAGGAAAGCACCCAAGAGG + Intergenic
1035816742 8:2549720-2549742 CAAATAGCACAGGAACCACTTGG - Intergenic
1036577119 8:10038437-10038459 CACATAGCACATTCACCAATAGG + Intergenic
1037498439 8:19462926-19462948 CATAGAGCATAGTACCCAATAGG + Intronic
1038938770 8:32281152-32281174 AGCATAGCATAGTACCCAATAGG + Intronic
1038993296 8:32893320-32893342 CACATGGCCCAGCCCCAAATGGG - Intergenic
1040029497 8:42811831-42811853 CAGAGTGCACAGCACACAATAGG - Intergenic
1040973302 8:53161520-53161542 CACTCAGCATAGCACCCAATAGG + Intergenic
1041783648 8:61607130-61607152 CACAGAGCATAGCACACAAAAGG + Intronic
1041892181 8:62881519-62881541 CAAATAGCACATCGCTCAATAGG + Intronic
1042098860 8:65250738-65250760 AAAATAGCACAGAACCAAATTGG - Intergenic
1043877439 8:85501524-85501546 CACAGAGCCCAGCACCTAATGGG - Intergenic
1044169702 8:89034234-89034256 CACCCAGCAAAGTACCCAATAGG - Intergenic
1046523072 8:115350313-115350335 TACATAGTACAGGAACCAATAGG - Intergenic
1047065219 8:121274412-121274434 CAGTGAGCACAGTACCCAATAGG + Intergenic
1047478857 8:125261422-125261444 CACAGAGCACAGAAGCCAAATGG - Intronic
1048883126 8:138886350-138886372 CACAAAGCCCAGCACAGAATTGG + Intronic
1049361337 8:142213767-142213789 CACCTGGCTCAGCACCCAAGAGG - Intronic
1049421334 8:142517924-142517946 CACAGAGCACAGCCCCGAAAGGG + Intronic
1052902083 9:33801945-33801967 CAGTGAGCACAGTACCCAATAGG + Intergenic
1055148699 9:72967878-72967900 TACTGAGCACAGTACCCAATAGG + Intronic
1058156133 9:101517990-101518012 CAGTGAGCACAGCACCCAATAGG + Intronic
1058419218 9:104818789-104818811 CACACAGCACAGCTTCCCATGGG + Exonic
1058783861 9:108366445-108366467 CACATTGCTCAGTACCTAATCGG + Intergenic
1061407453 9:130400263-130400285 CACATGCCACTGCACCCAGTGGG - Intronic
1186666959 X:11726953-11726975 TACTGAGCATAGCACCCAATAGG + Intergenic
1192251280 X:69416218-69416240 TACTAAGCACAGCACCCAATAGG + Intergenic
1192418537 X:71007219-71007241 CACATAGCACATCACCCAGTTGG - Intergenic
1194431777 X:93816740-93816762 CACACAGCACAGTTCACAATAGG + Intergenic
1197809686 X:130430090-130430112 CACACAGCACACCACACAAGCGG + Intergenic
1198976875 X:142345590-142345612 CAGTGAGCACAGAACCCAATAGG - Intergenic
1199984291 X:152939324-152939346 CACCTAGCACAGCACAGTATTGG - Intronic