ID: 1074394997

View in Genome Browser
Species Human (GRCh38)
Location 10:113090407-113090429
Sequence CAGAAAGCAGTGCCTCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074394993_1074394997 15 Left 1074394993 10:113090369-113090391 CCTATTGGGTGCTGTGCTATGTG 0: 1
1: 0
2: 3
3: 21
4: 154
Right 1074394997 10:113090407-113090429 CAGAAAGCAGTGCCTCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074394997 Original CRISPR CAGAAAGCAGTGCCTCCAGC AGG Intronic
No off target data available for this crispr