ID: 1074404403

View in Genome Browser
Species Human (GRCh38)
Location 10:113168782-113168804
Sequence GAAAATGCACATAAACAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074404403_1074404404 6 Left 1074404403 10:113168782-113168804 CCAAGCTGTTTATGTGCATTTTC No data
Right 1074404404 10:113168811-113168833 AATCCTAACACTACCACCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074404403 Original CRISPR GAAAATGCACATAAACAGCT TGG (reversed) Intergenic
No off target data available for this crispr