ID: 1074406406

View in Genome Browser
Species Human (GRCh38)
Location 10:113183668-113183690
Sequence CTGTGCACAAGGAGCAAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074406406_1074406415 9 Left 1074406406 10:113183668-113183690 CCGGCCTTGCTCCTTGTGCACAG No data
Right 1074406415 10:113183700-113183722 TGGCCATGAGAGATGCCGGCGGG No data
1074406406_1074406420 26 Left 1074406406 10:113183668-113183690 CCGGCCTTGCTCCTTGTGCACAG No data
Right 1074406420 10:113183717-113183739 GGCGGGGAGCCCAGGCTTTCAGG No data
1074406406_1074406416 10 Left 1074406406 10:113183668-113183690 CCGGCCTTGCTCCTTGTGCACAG No data
Right 1074406416 10:113183701-113183723 GGCCATGAGAGATGCCGGCGGGG No data
1074406406_1074406414 8 Left 1074406406 10:113183668-113183690 CCGGCCTTGCTCCTTGTGCACAG No data
Right 1074406414 10:113183699-113183721 CTGGCCATGAGAGATGCCGGCGG No data
1074406406_1074406412 5 Left 1074406406 10:113183668-113183690 CCGGCCTTGCTCCTTGTGCACAG No data
Right 1074406412 10:113183696-113183718 GGCCTGGCCATGAGAGATGCCGG No data
1074406406_1074406418 18 Left 1074406406 10:113183668-113183690 CCGGCCTTGCTCCTTGTGCACAG No data
Right 1074406418 10:113183709-113183731 GAGATGCCGGCGGGGAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074406406 Original CRISPR CTGTGCACAAGGAGCAAGGC CGG (reversed) Intergenic
No off target data available for this crispr