ID: 1074406412

View in Genome Browser
Species Human (GRCh38)
Location 10:113183696-113183718
Sequence GGCCTGGCCATGAGAGATGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074406407_1074406412 1 Left 1074406407 10:113183672-113183694 CCTTGCTCCTTGTGCACAGTGCT No data
Right 1074406412 10:113183696-113183718 GGCCTGGCCATGAGAGATGCCGG No data
1074406400_1074406412 28 Left 1074406400 10:113183645-113183667 CCAGGCCCCATGCAGGCTTCGGG No data
Right 1074406412 10:113183696-113183718 GGCCTGGCCATGAGAGATGCCGG No data
1074406410_1074406412 -6 Left 1074406410 10:113183679-113183701 CCTTGTGCACAGTGCTGGGCCTG No data
Right 1074406412 10:113183696-113183718 GGCCTGGCCATGAGAGATGCCGG No data
1074406406_1074406412 5 Left 1074406406 10:113183668-113183690 CCGGCCTTGCTCCTTGTGCACAG No data
Right 1074406412 10:113183696-113183718 GGCCTGGCCATGAGAGATGCCGG No data
1074406403_1074406412 23 Left 1074406403 10:113183650-113183672 CCCCATGCAGGCTTCGGGCCGGC No data
Right 1074406412 10:113183696-113183718 GGCCTGGCCATGAGAGATGCCGG No data
1074406398_1074406412 29 Left 1074406398 10:113183644-113183666 CCCAGGCCCCATGCAGGCTTCGG No data
Right 1074406412 10:113183696-113183718 GGCCTGGCCATGAGAGATGCCGG No data
1074406404_1074406412 22 Left 1074406404 10:113183651-113183673 CCCATGCAGGCTTCGGGCCGGCC No data
Right 1074406412 10:113183696-113183718 GGCCTGGCCATGAGAGATGCCGG No data
1074406405_1074406412 21 Left 1074406405 10:113183652-113183674 CCATGCAGGCTTCGGGCCGGCCT No data
Right 1074406412 10:113183696-113183718 GGCCTGGCCATGAGAGATGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074406412 Original CRISPR GGCCTGGCCATGAGAGATGC CGG Intergenic
No off target data available for this crispr