ID: 1074406415

View in Genome Browser
Species Human (GRCh38)
Location 10:113183700-113183722
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074406406_1074406415 9 Left 1074406406 10:113183668-113183690 CCGGCCTTGCTCCTTGTGCACAG No data
Right 1074406415 10:113183700-113183722 TGGCCATGAGAGATGCCGGCGGG No data
1074406405_1074406415 25 Left 1074406405 10:113183652-113183674 CCATGCAGGCTTCGGGCCGGCCT No data
Right 1074406415 10:113183700-113183722 TGGCCATGAGAGATGCCGGCGGG No data
1074406403_1074406415 27 Left 1074406403 10:113183650-113183672 CCCCATGCAGGCTTCGGGCCGGC No data
Right 1074406415 10:113183700-113183722 TGGCCATGAGAGATGCCGGCGGG No data
1074406410_1074406415 -2 Left 1074406410 10:113183679-113183701 CCTTGTGCACAGTGCTGGGCCTG No data
Right 1074406415 10:113183700-113183722 TGGCCATGAGAGATGCCGGCGGG No data
1074406407_1074406415 5 Left 1074406407 10:113183672-113183694 CCTTGCTCCTTGTGCACAGTGCT No data
Right 1074406415 10:113183700-113183722 TGGCCATGAGAGATGCCGGCGGG No data
1074406404_1074406415 26 Left 1074406404 10:113183651-113183673 CCCATGCAGGCTTCGGGCCGGCC No data
Right 1074406415 10:113183700-113183722 TGGCCATGAGAGATGCCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074406415 Original CRISPR TGGCCATGAGAGATGCCGGC GGG Intergenic
No off target data available for this crispr