ID: 1074406418

View in Genome Browser
Species Human (GRCh38)
Location 10:113183709-113183731
Sequence GAGATGCCGGCGGGGAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074406407_1074406418 14 Left 1074406407 10:113183672-113183694 CCTTGCTCCTTGTGCACAGTGCT No data
Right 1074406418 10:113183709-113183731 GAGATGCCGGCGGGGAGCCCAGG No data
1074406410_1074406418 7 Left 1074406410 10:113183679-113183701 CCTTGTGCACAGTGCTGGGCCTG No data
Right 1074406418 10:113183709-113183731 GAGATGCCGGCGGGGAGCCCAGG No data
1074406406_1074406418 18 Left 1074406406 10:113183668-113183690 CCGGCCTTGCTCCTTGTGCACAG No data
Right 1074406418 10:113183709-113183731 GAGATGCCGGCGGGGAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074406418 Original CRISPR GAGATGCCGGCGGGGAGCCC AGG Intergenic
No off target data available for this crispr