ID: 1074406420

View in Genome Browser
Species Human (GRCh38)
Location 10:113183717-113183739
Sequence GGCGGGGAGCCCAGGCTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074406417_1074406420 -9 Left 1074406417 10:113183703-113183725 CCATGAGAGATGCCGGCGGGGAG No data
Right 1074406420 10:113183717-113183739 GGCGGGGAGCCCAGGCTTTCAGG No data
1074406410_1074406420 15 Left 1074406410 10:113183679-113183701 CCTTGTGCACAGTGCTGGGCCTG No data
Right 1074406420 10:113183717-113183739 GGCGGGGAGCCCAGGCTTTCAGG No data
1074406407_1074406420 22 Left 1074406407 10:113183672-113183694 CCTTGCTCCTTGTGCACAGTGCT No data
Right 1074406420 10:113183717-113183739 GGCGGGGAGCCCAGGCTTTCAGG No data
1074406413_1074406420 -4 Left 1074406413 10:113183698-113183720 CCTGGCCATGAGAGATGCCGGCG No data
Right 1074406420 10:113183717-113183739 GGCGGGGAGCCCAGGCTTTCAGG No data
1074406406_1074406420 26 Left 1074406406 10:113183668-113183690 CCGGCCTTGCTCCTTGTGCACAG No data
Right 1074406420 10:113183717-113183739 GGCGGGGAGCCCAGGCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074406420 Original CRISPR GGCGGGGAGCCCAGGCTTTC AGG Intergenic
No off target data available for this crispr