ID: 1074413602

View in Genome Browser
Species Human (GRCh38)
Location 10:113248123-113248145
Sequence CTGTGACTATGGGAGTAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074413593_1074413602 19 Left 1074413593 10:113248081-113248103 CCCTCCATAAACAATCTGATTCC No data
Right 1074413602 10:113248123-113248145 CTGTGACTATGGGAGTAAGTTGG No data
1074413594_1074413602 18 Left 1074413594 10:113248082-113248104 CCTCCATAAACAATCTGATTCCT No data
Right 1074413602 10:113248123-113248145 CTGTGACTATGGGAGTAAGTTGG No data
1074413599_1074413602 -2 Left 1074413599 10:113248102-113248124 CCTCTTTGGAAATATTGGTGGCT No data
Right 1074413602 10:113248123-113248145 CTGTGACTATGGGAGTAAGTTGG No data
1074413595_1074413602 15 Left 1074413595 10:113248085-113248107 CCATAAACAATCTGATTCCTCTT No data
Right 1074413602 10:113248123-113248145 CTGTGACTATGGGAGTAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074413602 Original CRISPR CTGTGACTATGGGAGTAAGT TGG Intergenic
No off target data available for this crispr