ID: 1074420414

View in Genome Browser
Species Human (GRCh38)
Location 10:113303813-113303835
Sequence TTGCATAACCACCACCAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074420414_1074420415 -10 Left 1074420414 10:113303813-113303835 CCTATTTGGTGGTGGTTATGCAA No data
Right 1074420415 10:113303826-113303848 GGTTATGCAAATCTATATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074420414 Original CRISPR TTGCATAACCACCACCAAAT AGG (reversed) Intergenic
No off target data available for this crispr