ID: 1074422221

View in Genome Browser
Species Human (GRCh38)
Location 10:113319442-113319464
Sequence CTGCCATAAATGACTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074422221_1074422228 18 Left 1074422221 10:113319442-113319464 CCTCCCAAAGTCATTTATGGCAG No data
Right 1074422228 10:113319483-113319505 AGCCCCAAGTTAGTCCTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074422221 Original CRISPR CTGCCATAAATGACTTTGGG AGG (reversed) Intergenic
No off target data available for this crispr