ID: 1074424869

View in Genome Browser
Species Human (GRCh38)
Location 10:113342048-113342070
Sequence ATTGTAAGTAGCCCCCTAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074424869_1074424875 29 Left 1074424869 10:113342048-113342070 CCAATTAGGGGGCTACTTACAAT No data
Right 1074424875 10:113342100-113342122 CTGAGCAAGGCTGAGCCTTAAGG No data
1074424869_1074424872 5 Left 1074424869 10:113342048-113342070 CCAATTAGGGGGCTACTTACAAT No data
Right 1074424872 10:113342076-113342098 ACTTCAGAGATTCATACTAAGGG No data
1074424869_1074424876 30 Left 1074424869 10:113342048-113342070 CCAATTAGGGGGCTACTTACAAT No data
Right 1074424876 10:113342101-113342123 TGAGCAAGGCTGAGCCTTAAGGG No data
1074424869_1074424871 4 Left 1074424869 10:113342048-113342070 CCAATTAGGGGGCTACTTACAAT No data
Right 1074424871 10:113342075-113342097 CACTTCAGAGATTCATACTAAGG No data
1074424869_1074424873 16 Left 1074424869 10:113342048-113342070 CCAATTAGGGGGCTACTTACAAT No data
Right 1074424873 10:113342087-113342109 TCATACTAAGGGCCTGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074424869 Original CRISPR ATTGTAAGTAGCCCCCTAAT TGG (reversed) Intergenic
No off target data available for this crispr