ID: 1074424871

View in Genome Browser
Species Human (GRCh38)
Location 10:113342075-113342097
Sequence CACTTCAGAGATTCATACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074424869_1074424871 4 Left 1074424869 10:113342048-113342070 CCAATTAGGGGGCTACTTACAAT No data
Right 1074424871 10:113342075-113342097 CACTTCAGAGATTCATACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074424871 Original CRISPR CACTTCAGAGATTCATACTA AGG Intergenic
No off target data available for this crispr