ID: 1074424935

View in Genome Browser
Species Human (GRCh38)
Location 10:113342426-113342448
Sequence CTGGTCTCCTGGGGAAACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074424929_1074424935 4 Left 1074424929 10:113342399-113342421 CCTGTAATCCATGGGCAGTAGAG No data
Right 1074424935 10:113342426-113342448 CTGGTCTCCTGGGGAAACAGTGG No data
1074424930_1074424935 -4 Left 1074424930 10:113342407-113342429 CCATGGGCAGTAGAGTGCTCTGG No data
Right 1074424935 10:113342426-113342448 CTGGTCTCCTGGGGAAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074424935 Original CRISPR CTGGTCTCCTGGGGAAACAG TGG Intergenic
No off target data available for this crispr