ID: 1074431137

View in Genome Browser
Species Human (GRCh38)
Location 10:113395798-113395820
Sequence GTGTCTCTCTAGGACTATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074431137_1074431144 27 Left 1074431137 10:113395798-113395820 CCCTCATAGTCCTAGAGAGACAC No data
Right 1074431144 10:113395848-113395870 ACAAAGCCAGCATCACAGGCAGG No data
1074431137_1074431142 23 Left 1074431137 10:113395798-113395820 CCCTCATAGTCCTAGAGAGACAC No data
Right 1074431142 10:113395844-113395866 TTCCACAAAGCCAGCATCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074431137 Original CRISPR GTGTCTCTCTAGGACTATGA GGG (reversed) Intergenic
No off target data available for this crispr