ID: 1074434294

View in Genome Browser
Species Human (GRCh38)
Location 10:113420823-113420845
Sequence AGCTCTGATAGTTAGGGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074434294_1074434303 16 Left 1074434294 10:113420823-113420845 CCCCTTCCCTAACTATCAGAGCT No data
Right 1074434303 10:113420862-113420884 GTGGCTAATGACCCGGCACTTGG No data
1074434294_1074434299 -3 Left 1074434294 10:113420823-113420845 CCCCTTCCCTAACTATCAGAGCT No data
Right 1074434299 10:113420843-113420865 GCTTTTCTCTCCCATGACTGTGG No data
1074434294_1074434306 30 Left 1074434294 10:113420823-113420845 CCCCTTCCCTAACTATCAGAGCT No data
Right 1074434306 10:113420876-113420898 GGCACTTGGAATGCACCCCACGG No data
1074434294_1074434302 9 Left 1074434294 10:113420823-113420845 CCCCTTCCCTAACTATCAGAGCT No data
Right 1074434302 10:113420855-113420877 CATGACTGTGGCTAATGACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074434294 Original CRISPR AGCTCTGATAGTTAGGGAAG GGG (reversed) Intergenic
No off target data available for this crispr