ID: 1074434297

View in Genome Browser
Species Human (GRCh38)
Location 10:113420829-113420851
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074434297_1074434302 3 Left 1074434297 10:113420829-113420851 CCCTAACTATCAGAGCTTTTCTC No data
Right 1074434302 10:113420855-113420877 CATGACTGTGGCTAATGACCCGG No data
1074434297_1074434299 -9 Left 1074434297 10:113420829-113420851 CCCTAACTATCAGAGCTTTTCTC No data
Right 1074434299 10:113420843-113420865 GCTTTTCTCTCCCATGACTGTGG No data
1074434297_1074434306 24 Left 1074434297 10:113420829-113420851 CCCTAACTATCAGAGCTTTTCTC No data
Right 1074434306 10:113420876-113420898 GGCACTTGGAATGCACCCCACGG No data
1074434297_1074434303 10 Left 1074434297 10:113420829-113420851 CCCTAACTATCAGAGCTTTTCTC No data
Right 1074434303 10:113420862-113420884 GTGGCTAATGACCCGGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074434297 Original CRISPR GAGAAAAGCTCTGATAGTTA GGG (reversed) Intergenic
No off target data available for this crispr