ID: 1074434298

View in Genome Browser
Species Human (GRCh38)
Location 10:113420830-113420852
Sequence AGAGAAAAGCTCTGATAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074434298_1074434302 2 Left 1074434298 10:113420830-113420852 CCTAACTATCAGAGCTTTTCTCT No data
Right 1074434302 10:113420855-113420877 CATGACTGTGGCTAATGACCCGG No data
1074434298_1074434299 -10 Left 1074434298 10:113420830-113420852 CCTAACTATCAGAGCTTTTCTCT No data
Right 1074434299 10:113420843-113420865 GCTTTTCTCTCCCATGACTGTGG No data
1074434298_1074434306 23 Left 1074434298 10:113420830-113420852 CCTAACTATCAGAGCTTTTCTCT No data
Right 1074434306 10:113420876-113420898 GGCACTTGGAATGCACCCCACGG No data
1074434298_1074434303 9 Left 1074434298 10:113420830-113420852 CCTAACTATCAGAGCTTTTCTCT No data
Right 1074434303 10:113420862-113420884 GTGGCTAATGACCCGGCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074434298 Original CRISPR AGAGAAAAGCTCTGATAGTT AGG (reversed) Intergenic
No off target data available for this crispr