ID: 1074434299

View in Genome Browser
Species Human (GRCh38)
Location 10:113420843-113420865
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074434294_1074434299 -3 Left 1074434294 10:113420823-113420845 CCCCTTCCCTAACTATCAGAGCT No data
Right 1074434299 10:113420843-113420865 GCTTTTCTCTCCCATGACTGTGG No data
1074434296_1074434299 -5 Left 1074434296 10:113420825-113420847 CCTTCCCTAACTATCAGAGCTTT No data
Right 1074434299 10:113420843-113420865 GCTTTTCTCTCCCATGACTGTGG No data
1074434297_1074434299 -9 Left 1074434297 10:113420829-113420851 CCCTAACTATCAGAGCTTTTCTC No data
Right 1074434299 10:113420843-113420865 GCTTTTCTCTCCCATGACTGTGG No data
1074434298_1074434299 -10 Left 1074434298 10:113420830-113420852 CCTAACTATCAGAGCTTTTCTCT No data
Right 1074434299 10:113420843-113420865 GCTTTTCTCTCCCATGACTGTGG No data
1074434295_1074434299 -4 Left 1074434295 10:113420824-113420846 CCCTTCCCTAACTATCAGAGCTT No data
Right 1074434299 10:113420843-113420865 GCTTTTCTCTCCCATGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074434299 Original CRISPR GCTTTTCTCTCCCATGACTG TGG Intergenic