ID: 1074434306

View in Genome Browser
Species Human (GRCh38)
Location 10:113420876-113420898
Sequence GGCACTTGGAATGCACCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074434298_1074434306 23 Left 1074434298 10:113420830-113420852 CCTAACTATCAGAGCTTTTCTCT No data
Right 1074434306 10:113420876-113420898 GGCACTTGGAATGCACCCCACGG No data
1074434301_1074434306 -1 Left 1074434301 10:113420854-113420876 CCATGACTGTGGCTAATGACCCG No data
Right 1074434306 10:113420876-113420898 GGCACTTGGAATGCACCCCACGG No data
1074434294_1074434306 30 Left 1074434294 10:113420823-113420845 CCCCTTCCCTAACTATCAGAGCT No data
Right 1074434306 10:113420876-113420898 GGCACTTGGAATGCACCCCACGG No data
1074434296_1074434306 28 Left 1074434296 10:113420825-113420847 CCTTCCCTAACTATCAGAGCTTT No data
Right 1074434306 10:113420876-113420898 GGCACTTGGAATGCACCCCACGG No data
1074434297_1074434306 24 Left 1074434297 10:113420829-113420851 CCCTAACTATCAGAGCTTTTCTC No data
Right 1074434306 10:113420876-113420898 GGCACTTGGAATGCACCCCACGG No data
1074434295_1074434306 29 Left 1074434295 10:113420824-113420846 CCCTTCCCTAACTATCAGAGCTT No data
Right 1074434306 10:113420876-113420898 GGCACTTGGAATGCACCCCACGG No data
1074434300_1074434306 0 Left 1074434300 10:113420853-113420875 CCCATGACTGTGGCTAATGACCC No data
Right 1074434306 10:113420876-113420898 GGCACTTGGAATGCACCCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074434306 Original CRISPR GGCACTTGGAATGCACCCCA CGG Intergenic
No off target data available for this crispr