ID: 1074435682

View in Genome Browser
Species Human (GRCh38)
Location 10:113432302-113432324
Sequence TCTTATGCAGAGATGGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074435682_1074435689 17 Left 1074435682 10:113432302-113432324 CCTGGCTCCATCTCTGCATAAGA No data
Right 1074435689 10:113432342-113432364 CGGCACTAAGGAGCCAAAATGGG No data
1074435682_1074435687 5 Left 1074435682 10:113432302-113432324 CCTGGCTCCATCTCTGCATAAGA No data
Right 1074435687 10:113432330-113432352 TGGGTTTGCTCTCGGCACTAAGG No data
1074435682_1074435688 16 Left 1074435682 10:113432302-113432324 CCTGGCTCCATCTCTGCATAAGA No data
Right 1074435688 10:113432341-113432363 TCGGCACTAAGGAGCCAAAATGG No data
1074435682_1074435686 -3 Left 1074435682 10:113432302-113432324 CCTGGCTCCATCTCTGCATAAGA No data
Right 1074435686 10:113432322-113432344 AGAGAGAATGGGTTTGCTCTCGG No data
1074435682_1074435691 30 Left 1074435682 10:113432302-113432324 CCTGGCTCCATCTCTGCATAAGA No data
Right 1074435691 10:113432355-113432377 CCAAAATGGGCGCCATGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074435682 Original CRISPR TCTTATGCAGAGATGGAGCC AGG (reversed) Intergenic
No off target data available for this crispr