ID: 1074436305

View in Genome Browser
Species Human (GRCh38)
Location 10:113437191-113437213
Sequence TTGCTGCTTAAGCCAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074436298_1074436305 14 Left 1074436298 10:113437154-113437176 CCTAGAATCCTAGATGCATTTGC No data
Right 1074436305 10:113437191-113437213 TTGCTGCTTAAGCCAGTGGAGGG No data
1074436295_1074436305 22 Left 1074436295 10:113437146-113437168 CCCCTGCTCCTAGAATCCTAGAT No data
Right 1074436305 10:113437191-113437213 TTGCTGCTTAAGCCAGTGGAGGG No data
1074436302_1074436305 -10 Left 1074436302 10:113437178-113437200 CCATGCAGCTCTCTTGCTGCTTA No data
Right 1074436305 10:113437191-113437213 TTGCTGCTTAAGCCAGTGGAGGG No data
1074436299_1074436305 6 Left 1074436299 10:113437162-113437184 CCTAGATGCATTTGCCCCATGCA No data
Right 1074436305 10:113437191-113437213 TTGCTGCTTAAGCCAGTGGAGGG No data
1074436297_1074436305 20 Left 1074436297 10:113437148-113437170 CCTGCTCCTAGAATCCTAGATGC No data
Right 1074436305 10:113437191-113437213 TTGCTGCTTAAGCCAGTGGAGGG No data
1074436301_1074436305 -9 Left 1074436301 10:113437177-113437199 CCCATGCAGCTCTCTTGCTGCTT No data
Right 1074436305 10:113437191-113437213 TTGCTGCTTAAGCCAGTGGAGGG No data
1074436300_1074436305 -8 Left 1074436300 10:113437176-113437198 CCCCATGCAGCTCTCTTGCTGCT No data
Right 1074436305 10:113437191-113437213 TTGCTGCTTAAGCCAGTGGAGGG No data
1074436296_1074436305 21 Left 1074436296 10:113437147-113437169 CCCTGCTCCTAGAATCCTAGATG No data
Right 1074436305 10:113437191-113437213 TTGCTGCTTAAGCCAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074436305 Original CRISPR TTGCTGCTTAAGCCAGTGGA GGG Intergenic