ID: 1074438039

View in Genome Browser
Species Human (GRCh38)
Location 10:113451260-113451282
Sequence TCTGATCAGCAGGCAGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074438036_1074438039 3 Left 1074438036 10:113451234-113451256 CCTTGGTGTTTGGGTAGAAGATG No data
Right 1074438039 10:113451260-113451282 TCTGATCAGCAGGCAGTGCATGG No data
1074438033_1074438039 18 Left 1074438033 10:113451219-113451241 CCAATTAGGTGGTTGCCTTGGTG No data
Right 1074438039 10:113451260-113451282 TCTGATCAGCAGGCAGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074438039 Original CRISPR TCTGATCAGCAGGCAGTGCA TGG Intergenic
No off target data available for this crispr