ID: 1074438178

View in Genome Browser
Species Human (GRCh38)
Location 10:113452345-113452367
Sequence CCTAAAAAGGGCCTTCCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074438172_1074438178 -10 Left 1074438172 10:113452332-113452354 CCCTCTCCTGTGACCTAAAAAGG No data
Right 1074438178 10:113452345-113452367 CCTAAAAAGGGCCTTCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074438178 Original CRISPR CCTAAAAAGGGCCTTCCCTC AGG Intergenic
No off target data available for this crispr