ID: 1074438623

View in Genome Browser
Species Human (GRCh38)
Location 10:113455622-113455644
Sequence ATGGGGAAACAGACTCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074438623_1074438627 -6 Left 1074438623 10:113455622-113455644 CCATCCTGAGTCTGTTTCCCCAT No data
Right 1074438627 10:113455639-113455661 CCCCATCTTTGTGTTACTGGTGG No data
1074438623_1074438630 -3 Left 1074438623 10:113455622-113455644 CCATCCTGAGTCTGTTTCCCCAT No data
Right 1074438630 10:113455642-113455664 CATCTTTGTGTTACTGGTGGAGG No data
1074438623_1074438625 -9 Left 1074438623 10:113455622-113455644 CCATCCTGAGTCTGTTTCCCCAT No data
Right 1074438625 10:113455636-113455658 TTTCCCCATCTTTGTGTTACTGG No data
1074438623_1074438631 6 Left 1074438623 10:113455622-113455644 CCATCCTGAGTCTGTTTCCCCAT No data
Right 1074438631 10:113455651-113455673 GTTACTGGTGGAGGATGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074438623 Original CRISPR ATGGGGAAACAGACTCAGGA TGG (reversed) Intergenic
No off target data available for this crispr