ID: 1074443849

View in Genome Browser
Species Human (GRCh38)
Location 10:113501808-113501830
Sequence GCTTCCAACTCAGGCTCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074443836_1074443849 22 Left 1074443836 10:113501763-113501785 CCCCTTTGCAGTGAATAGTAGCA No data
Right 1074443849 10:113501808-113501830 GCTTCCAACTCAGGCTCACTGGG No data
1074443843_1074443849 -6 Left 1074443843 10:113501791-113501813 CCCCAGCCACACTCTGGGCTTCC No data
Right 1074443849 10:113501808-113501830 GCTTCCAACTCAGGCTCACTGGG No data
1074443838_1074443849 20 Left 1074443838 10:113501765-113501787 CCTTTGCAGTGAATAGTAGCAGT No data
Right 1074443849 10:113501808-113501830 GCTTCCAACTCAGGCTCACTGGG No data
1074443837_1074443849 21 Left 1074443837 10:113501764-113501786 CCCTTTGCAGTGAATAGTAGCAG No data
Right 1074443849 10:113501808-113501830 GCTTCCAACTCAGGCTCACTGGG No data
1074443842_1074443849 -5 Left 1074443842 10:113501790-113501812 CCCCCAGCCACACTCTGGGCTTC No data
Right 1074443849 10:113501808-113501830 GCTTCCAACTCAGGCTCACTGGG No data
1074443844_1074443849 -7 Left 1074443844 10:113501792-113501814 CCCAGCCACACTCTGGGCTTCCA No data
Right 1074443849 10:113501808-113501830 GCTTCCAACTCAGGCTCACTGGG No data
1074443845_1074443849 -8 Left 1074443845 10:113501793-113501815 CCAGCCACACTCTGGGCTTCCAA No data
Right 1074443849 10:113501808-113501830 GCTTCCAACTCAGGCTCACTGGG No data
1074443835_1074443849 30 Left 1074443835 10:113501755-113501777 CCTGTCTTCCCCTTTGCAGTGAA No data
Right 1074443849 10:113501808-113501830 GCTTCCAACTCAGGCTCACTGGG No data
1074443841_1074443849 -4 Left 1074443841 10:113501789-113501811 CCCCCCAGCCACACTCTGGGCTT No data
Right 1074443849 10:113501808-113501830 GCTTCCAACTCAGGCTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074443849 Original CRISPR GCTTCCAACTCAGGCTCACT GGG Intergenic
No off target data available for this crispr