ID: 1074448201

View in Genome Browser
Species Human (GRCh38)
Location 10:113537771-113537793
Sequence TGCCTGGGTTGAGGGAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074448201_1074448208 -6 Left 1074448201 10:113537771-113537793 CCTGCCCTCCCTCAACCCAGGCA No data
Right 1074448208 10:113537788-113537810 CAGGCAGCAAGCCCCCACCCAGG No data
1074448201_1074448216 23 Left 1074448201 10:113537771-113537793 CCTGCCCTCCCTCAACCCAGGCA No data
Right 1074448216 10:113537817-113537839 TTTCCTCAGCACCAAAGTCCAGG No data
1074448201_1074448217 24 Left 1074448201 10:113537771-113537793 CCTGCCCTCCCTCAACCCAGGCA No data
Right 1074448217 10:113537818-113537840 TTCCTCAGCACCAAAGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074448201 Original CRISPR TGCCTGGGTTGAGGGAGGGC AGG (reversed) Intergenic
No off target data available for this crispr