ID: 1074451094

View in Genome Browser
Species Human (GRCh38)
Location 10:113560178-113560200
Sequence TTTGCTTTCACCTGAAGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 231}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074451094_1074451095 7 Left 1074451094 10:113560178-113560200 CCTGAGCTTCAGGTGAAAGCAAA 0: 1
1: 1
2: 1
3: 19
4: 231
Right 1074451095 10:113560208-113560230 TGAACCTGCCAGTCTTGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074451094 Original CRISPR TTTGCTTTCACCTGAAGCTC AGG (reversed) Intronic
902357317 1:15914139-15914161 TGTACTTTCACATGAAACTCAGG - Intronic
906255731 1:44348489-44348511 TTTGATTTTACCTGTAGCTGTGG + Intronic
906516381 1:46441191-46441213 TGTGCTCTCACCTGATGCTAGGG - Intergenic
907614303 1:55908116-55908138 TTTTCTTTCCCCTGAAACTGTGG - Intergenic
910225162 1:84928929-84928951 TTTGCTTTCATCTGAAGTCAGGG - Intronic
913455678 1:119028230-119028252 TTTGTTTTCAGCTCAATCTCAGG + Intergenic
913490021 1:119370408-119370430 TGTGATTTCATCTGAGGCTCTGG - Intronic
914939633 1:152011523-152011545 TGTGCTTTCATCTAGAGCTCAGG + Intergenic
915554319 1:156652935-156652957 TTTTCTTCCCCCTGCAGCTCTGG + Intronic
916635220 1:166660994-166661016 TTTCCTTTCACCTTAATCACAGG - Intergenic
919771807 1:201166004-201166026 TTTTCTATCAGCTGAAGGTCTGG - Intronic
921580385 1:216889580-216889602 TCTGATTTCACCTAAATCTCTGG + Intronic
1064980579 10:21162417-21162439 TTTGCTCTCACTTCAAGCCCAGG - Intronic
1065625735 10:27626757-27626779 TTGGCTTTGCCCTGAAGTTCTGG - Intergenic
1069682235 10:70293386-70293408 TTTCCTTTCACGTCAAGCTTTGG + Intergenic
1069697419 10:70396994-70397016 GTTGCTTTCACCTGCAGTCCAGG + Intergenic
1070427490 10:76303861-76303883 CTCGCTTTCATCTGCAGCTCGGG + Intronic
1070914643 10:80144996-80145018 TTTTATTTCACATGAAGCTAAGG - Exonic
1071340553 10:84643000-84643022 TTTTTTTTCACTTTAAGCTCTGG - Intergenic
1073568819 10:104558594-104558616 TTTCCTTTCAGCTGATGGTCAGG - Intergenic
1073609542 10:104929546-104929568 TTGGGATGCACCTGAAGCTCAGG - Intronic
1073629027 10:105129480-105129502 TTTTCTTTCACCTGAAGCTCTGG + Intronic
1074451094 10:113560178-113560200 TTTGCTTTCACCTGAAGCTCAGG - Intronic
1075135609 10:119782813-119782835 TTTGCTGTTACCTGATGTTCAGG - Intronic
1075162753 10:120039324-120039346 TTTTCTCTCTCCTCAAGCTCAGG - Intergenic
1075580955 10:123618044-123618066 TTTGCTTCCAGCTGGAGTTCTGG - Intergenic
1076482292 10:130792568-130792590 TTTGCGCTCACCTGCAGGTCAGG + Intergenic
1082932138 11:58619210-58619232 TTGGCTTTCACCTAAAATTCTGG + Exonic
1086846333 11:91754495-91754517 TTTACTTTCACCCCAAGCTTAGG + Intergenic
1087343023 11:96933289-96933311 TTTACTTTGACTTGTAGCTCAGG + Intergenic
1088325295 11:108594462-108594484 TTTGCTTTCACCAGAGGATTAGG - Intergenic
1090249914 11:125244097-125244119 CTTGCTTTGCCCTGTAGCTCAGG - Intronic
1090455315 11:126844028-126844050 CTTGCTTTCACTTTATGCTCTGG + Intronic
1095144512 12:38709710-38709732 TTTGCAATAACCTGAACCTCTGG - Intronic
1099650332 12:85418756-85418778 TTAGCTTTCCCTTGAATCTCAGG + Intergenic
1099918847 12:88931761-88931783 ATTGCTTTCATCTGCAGCTTAGG + Intergenic
1100219185 12:92485535-92485557 TTTCCTTTGACCTGAATCTTGGG - Intergenic
1100430759 12:94530113-94530135 TGTGCTTTCCCCTGTAGCTTTGG + Intergenic
1100778614 12:98000156-98000178 TTGGCCTTTACCTGAAGGTCTGG + Intergenic
1102630602 12:114275304-114275326 TTTGCTTTTCTATGAAGCTCCGG + Intergenic
1104284932 12:127416445-127416467 TGTGCTTTCACCTTACTCTCTGG + Intergenic
1104941477 12:132397461-132397483 TGGGCTTTCACCTGCATCTCTGG + Intergenic
1106550512 13:30766931-30766953 TGTGATCTCAGCTGAAGCTCAGG + Intergenic
1107624737 13:42271556-42271578 TTTGCTTTCTTCCGAAGCCCGGG - Intergenic
1108459051 13:50646999-50647021 TTTGTTTTTACTTTAAGCTCCGG + Intronic
1110363232 13:74652123-74652145 TGTGCATTCAAATGAAGCTCAGG + Intergenic
1110371351 13:74744083-74744105 ATTACTTTGACCTGAAGCCCAGG + Intergenic
1111909636 13:94296292-94296314 TTTGCTTTCACTTTAACTTCAGG + Intronic
1114044697 14:18863918-18863940 TTTTCTTTCCCCTTAAGGTCAGG + Intergenic
1114119526 14:19655607-19655629 TTTTCTTTCCCCTTAAGGTCAGG - Intergenic
1114367586 14:22046516-22046538 TTTCCTTTCACCTTAATCCCGGG + Intergenic
1114909902 14:27178292-27178314 TTTGCTTTCACTAAAAACTCAGG - Intergenic
1115424202 14:33236269-33236291 TTTTGTTTCACCTCAAGCTCTGG + Intronic
1118888964 14:69891493-69891515 TTTCCTTTCATCTGAAGGACAGG + Intronic
1119384313 14:74247696-74247718 TTTGCTTTGACTTGAAGCTGGGG + Intronic
1119852690 14:77877307-77877329 TTTGCTACCTCCTGAAGCCCAGG + Intronic
1120946213 14:90000035-90000057 TGTGCTCTCATCTGAAGCTTGGG + Intronic
1121943121 14:98092320-98092342 TTTGCTTCCTCCTGAATATCGGG - Intergenic
1123027352 14:105432957-105432979 ATCGCTTTCGACTGAAGCTCAGG - Intronic
1125465548 15:39948089-39948111 TTTTCTTACACCAGAAGCTGTGG - Intronic
1126789679 15:52209642-52209664 TTTGCTTCCCCTTGATGCTCTGG - Intronic
1126963917 15:54029803-54029825 TCTGATTTCAGCTGCAGCTCCGG + Intronic
1131014099 15:89043250-89043272 TTTGCTTTCAGCAGAAGAGCTGG + Intergenic
1131097709 15:89666617-89666639 TTTGCTCTCAACTGAAGGGCTGG - Intronic
1131648487 15:94372961-94372983 TTTAGTTTCACCTAAAGTTCAGG + Intronic
1133278318 16:4651308-4651330 TCTGCTTTCACCCCAAGCCCTGG - Intronic
1135470011 16:22721873-22721895 TTTCCTTTCACCAGCTGCTCTGG + Intergenic
1136079276 16:27840920-27840942 TTGGATGTCACCTGAAGCTGAGG - Intronic
1137409491 16:48215705-48215727 TTTTATTTCACCTGAATCTTTGG + Intronic
1138742668 16:59328966-59328988 ATTGCTTTCATCTGAAGCTGCGG + Intergenic
1139112895 16:63913604-63913626 TTTACTTTCACTTGAATCTAAGG - Intergenic
1140071098 16:71650292-71650314 TTTGCTTTAACATGAAGAACAGG + Intronic
1140831438 16:78755197-78755219 TTTCCTTTCACTTTAAGTTCTGG - Intronic
1141068597 16:80933472-80933494 AGTGATTTCACCTAAAGCTCTGG - Intergenic
1143278871 17:5735169-5735191 TTTCCTTTCACTTTAAGTTCTGG - Intergenic
1144102244 17:11952031-11952053 TTTGCCATCACAGGAAGCTCTGG + Intronic
1144739727 17:17575114-17575136 TGTGCTTCCACCAGAGGCTCTGG + Intronic
1145005755 17:19336866-19336888 TTTGGTTGCCCCTGAACCTCAGG + Intergenic
1147503202 17:40986363-40986385 TTTTCTATCAGCTGAAGGTCTGG - Intronic
1150144342 17:62755248-62755270 TCTGCTGTCACCTGGAGCTTGGG - Intronic
1150383681 17:64740649-64740671 TTTGCTTTTACCTAAAGCAGTGG - Intergenic
1153178365 18:2404892-2404914 TTTTTTTTCACCTTAAGTTCTGG + Intergenic
1155571583 18:27200662-27200684 TGTGTTCTCATCTGAAGCTCAGG + Intergenic
1156373840 18:36494762-36494784 TTGCCTTTCTCCTGAAGCTCTGG - Intronic
1156695914 18:39767224-39767246 GATGCTTTCTCCTGAAGATCTGG + Intergenic
1157255733 18:46137325-46137347 TTTTCTGTCACATGCAGCTCTGG + Intergenic
1157359003 18:46961739-46961761 TTTTCTCTCACCTGAATATCAGG - Intronic
1158224955 18:55191216-55191238 GTTGCTTTCACCTGGACCCCAGG + Intergenic
1160475080 18:79176736-79176758 TTTGATGGCACCTGTAGCTCAGG + Intronic
1160504876 18:79421425-79421447 TCTGCTTTCGCCTGGAGCCCTGG + Intronic
1161305940 19:3568112-3568134 TTTGCTTACAATTGAAACTCTGG + Intronic
1164915822 19:32051735-32051757 TTTACTTTCACCAAAAGCTTTGG + Intergenic
1168577894 19:57528240-57528262 TTTTCTTTTACCTGAACATCTGG + Intronic
928180528 2:29065300-29065322 TGTTCTTTCCCCTGAAGCCCTGG + Intronic
930321861 2:49864898-49864920 TTTTTTTTCACCTTAAGTTCTGG - Intergenic
930322002 2:49867083-49867105 TTTGCTTTCTTTTGATGCTCTGG - Intergenic
930526775 2:52540548-52540570 TTGGCTTTGACCTGAACCTCAGG - Intergenic
931593296 2:63910184-63910206 TTTGCTTTCATGTGTTGCTCAGG - Intronic
932480785 2:72037698-72037720 TTTGCTGACACATGAGGCTCTGG - Intergenic
935358366 2:102225881-102225903 TTTGCTGTCATTTGTAGCTCCGG + Exonic
935366448 2:102296578-102296600 TCTGCTTACACTTGAGGCTCAGG - Intergenic
936151626 2:110025115-110025137 TTTGCATGACCCTGAAGCTCAGG + Intergenic
936193048 2:110346254-110346276 TTTGCATGACCCTGAAGCTCAGG - Intergenic
937955263 2:127418605-127418627 TGTCCTTTCACCCCAAGCTCAGG - Intronic
938584171 2:132672427-132672449 ATTACTATCACCTGAATCTCTGG + Exonic
938623562 2:133083463-133083485 TTGGCTAAAACCTGAAGCTCTGG + Intronic
938925036 2:136031391-136031413 TCTGCTTTCACCTAAAGCCATGG - Intergenic
941036873 2:160578550-160578572 TTTGATCTCATCTGAGGCTCAGG + Intergenic
941331158 2:164178954-164178976 TTTCCTTTCACTCGAAGCACAGG - Intergenic
941654327 2:168126993-168127015 TTTGCTTTTAGATGAACCTCAGG - Intronic
945399018 2:209356479-209356501 TTTGCTTTCACTTGACCCTGTGG + Intergenic
945493213 2:210479697-210479719 TATGCTTTCACCTGTGGCTATGG + Intronic
947419000 2:229924552-229924574 TTTTCTTTCCCCTGAAGGTCTGG + Intronic
1170808773 20:19657119-19657141 TTTGCTGTTACCTGAAGATGTGG + Intronic
1170941751 20:20853949-20853971 TTTGCTTGCACCTCCAGCTGGGG - Intergenic
1173835061 20:46119407-46119429 TTCACTTTCACCTGAAGCAATGG + Intronic
1174101924 20:48133985-48134007 TTTGCATTCACCTGATGATTAGG - Intergenic
1176667109 21:9697906-9697928 GATGCTTTAACCTGCAGCTCGGG + Intergenic
1176906103 21:14503439-14503461 TGTGATCTCACCTGAGGCTCAGG - Intronic
1177372309 21:20219629-20219651 TTTGTTTTCAGTTGAGGCTCTGG - Intergenic
1177992829 21:28058944-28058966 TTTTTTTTCTCCTGAATCTCTGG - Intergenic
1178505616 21:33160509-33160531 TTTGTTTTCTCCTGAAGCAGTGG - Intergenic
1180463220 22:15586475-15586497 TTTTCTTTCCCCTTAAGGTCAGG + Intergenic
1182647919 22:31825419-31825441 TTTGCTGCAACCTGAAGCTCTGG + Intronic
1182819411 22:33202179-33202201 TCTGCTTTGACATGAAGCACTGG + Intronic
949102834 3:166540-166562 ACTGCTTTTACTTGAAGCTCTGG - Intergenic
949142942 3:657074-657096 TTTGCTTTCACCCGAAGAACTGG - Intergenic
949648132 3:6122247-6122269 TTTGCTTGAACAAGAAGCTCAGG - Intergenic
950662253 3:14473809-14473831 TTTTCTTTCACTTAGAGCTCTGG - Intronic
951229564 3:20161218-20161240 TTTGCTTTTACCAGGAGCCCTGG - Exonic
951504253 3:23424692-23424714 TTTGATTTCAGCTGGAGCTAAGG + Intronic
951690018 3:25385578-25385600 TTTGCTTTAATCTGAAGGTCTGG - Intronic
951864079 3:27287275-27287297 ATTTCTTTTACCTGAAGTTCAGG - Intronic
952707430 3:36393365-36393387 TCTGCTTTCTCCAGAAGCACCGG - Intronic
953384104 3:42495888-42495910 TGTGTTTTCATATGAAGCTCAGG - Intronic
955024786 3:55157034-55157056 TTCACTTTGACCTGAACCTCTGG + Intergenic
955032661 3:55236155-55236177 TTTGCTTTCATATGAATTTCAGG + Intergenic
955639556 3:61067619-61067641 TTTCTGTTCACCTGAAGCCCTGG - Intronic
956128496 3:66033502-66033524 TTTGGTTTCTCATGAATCTCTGG - Intronic
956883542 3:73535527-73535549 TTTGCTTTCACTTTAAGCTTTGG - Intronic
957140838 3:76353931-76353953 TTTGCTTTCACATGCATTTCTGG - Intronic
957963176 3:87287038-87287060 TTTGTTTTCACCAGCAGCCCAGG - Intergenic
958511589 3:95056336-95056358 TATATTTTCACTTGAAGCTCAGG - Intergenic
959785917 3:110296991-110297013 TTTGCTTTCTCCTCAAGTTTAGG - Intergenic
960384307 3:117002684-117002706 ATTGCTTTCACTTGAAGCTTAGG - Intronic
960692019 3:120356561-120356583 TTGACTTTCACCTGAAGCAGAGG - Intergenic
960988665 3:123296414-123296436 CCTGCTTGCACCTGCAGCTCAGG + Intronic
963301145 3:143598426-143598448 CCTGCTTTCACTTGAAGCTCAGG + Intronic
963970459 3:151423801-151423823 TTTCCTTTCATCTTAAACTCAGG + Intronic
964234115 3:154505483-154505505 TTTGCCTCCACCTGAATTTCTGG + Intergenic
964738874 3:159944547-159944569 TTTTCTTTCCCCTGAAGTGCAGG - Intergenic
965620885 3:170641397-170641419 TTTCCTAACAGCTGAAGCTCAGG - Intronic
969192912 4:5536836-5536858 TTTTCTTTCTCCTGAGGCTTTGG - Intergenic
970353397 4:15228559-15228581 TTTCCTTTAACCTGAACTTCAGG - Intergenic
970946616 4:21700316-21700338 TTTGCATTTACCTGATGATCAGG + Intronic
972564238 4:40255939-40255961 GATGCTTTCATCTGATGCTCTGG + Intergenic
972664675 4:41153169-41153191 TTTGCTTACACATAAAGCTTGGG + Intronic
972827459 4:42776719-42776741 TTACCTTTCACCTCAAGCTATGG - Intergenic
974081304 4:57216097-57216119 TTTGCTTTCTCTTGAGGTTCTGG + Intergenic
974888128 4:67846101-67846123 TTTCGTTTCACCAGAAGATCTGG + Intronic
975523945 4:75328956-75328978 TTTGCCTTCTCTTGAAGATCTGG - Intergenic
976178329 4:82376012-82376034 TTTGATTTCACATGTAGCTTAGG + Intergenic
976725503 4:88212105-88212127 TTGGTTTTCACCTAAAGCTAGGG - Intronic
979693332 4:123583915-123583937 TTTGCTTTCACATGGAGCTGGGG + Intergenic
980827433 4:138089285-138089307 TTTGTTTTAACCTGAACCTGGGG + Intergenic
981038301 4:140195233-140195255 TTAGCTGTCACGAGAAGCTCAGG + Intergenic
981933262 4:150212425-150212447 TTTGCTTTTCCCTGGAGCTTTGG + Intronic
982909986 4:161127890-161127912 TGTGTTTTCTTCTGAAGCTCTGG - Intergenic
982980934 4:162134159-162134181 TTTTCTTTCACCTCCATCTCTGG + Intronic
983346939 4:166538832-166538854 ATGGCTTTCCCCTGAAGATCAGG + Intergenic
984034369 4:174647486-174647508 TTTGTTTTCATCTTGAGCTCAGG - Intronic
985407900 4:189654431-189654453 GATGCTTTAACCTGCAGCTCGGG - Intergenic
986022253 5:3815210-3815232 AGTGCTTTCACCTGTAGCTGTGG - Intergenic
987166557 5:15204126-15204148 ATTGCTTTCACCTGAAGTCATGG - Intergenic
987456650 5:18155441-18155463 TGTGATCTCATCTGAAGCTCGGG - Intergenic
988536021 5:32069547-32069569 TTTGCTTTCTGCTGAAAATCAGG + Exonic
988900421 5:35726369-35726391 TTTCCTTTGACCTGAATCTCTGG - Intronic
989961681 5:50423495-50423517 TTTTCTATAATCTGAAGCTCTGG + Intronic
990513783 5:56513757-56513779 CTTACCTTAACCTGAAGCTCAGG + Exonic
990682460 5:58260624-58260646 CTTGCTTTCACCTAAATTTCGGG + Intergenic
992091204 5:73318769-73318791 TTTGATTTGACCTGATGGTCTGG + Intergenic
994831405 5:104787477-104787499 TTTCCTTTTACCAGAAGCCCTGG - Intergenic
995292998 5:110481865-110481887 TTAGCTTTCACCAGAATCCCAGG - Intronic
995863357 5:116664145-116664167 CTTGTTTTCACCTGAAGGGCTGG + Intergenic
996159706 5:120147318-120147340 TTTACTTTCATTTTAAGCTCAGG - Intergenic
998566458 5:143220265-143220287 TTTGATTTTTCCTGAAGCTTAGG + Intronic
1000463402 5:161548156-161548178 TTCCCTTCCTCCTGAAGCTCAGG + Intronic
1001532469 5:172473316-172473338 TTTGCTTTCAACTTAAACTGTGG - Intergenic
1004421312 6:15472634-15472656 TTTGCCTGCACCTGAACTTCAGG + Intronic
1005020176 6:21410350-21410372 TTTTCTTTTACTTGAAGTTCTGG - Intergenic
1009435416 6:63612753-63612775 TTTGTTTACAACTGAAACTCTGG + Intergenic
1009923988 6:70098025-70098047 TTTGCTTTCACTTCTATCTCTGG - Intronic
1010375173 6:75160356-75160378 ATTGCTTTCACCTGAAACTCAGG - Intronic
1010843420 6:80676076-80676098 TTTTCTTTCATATGAAGATCTGG + Intergenic
1011086257 6:83544578-83544600 TGTGCATTCACCAGAATCTCTGG - Intergenic
1013715572 6:112956895-112956917 TTTTCTTTCAGCTAATGCTCTGG - Intergenic
1014337777 6:120159594-120159616 TTTTATTTTACCTGAAGTTCTGG + Intergenic
1014430342 6:121363034-121363056 TTGTCATTCACCTGAACCTCTGG + Intergenic
1015022720 6:128495773-128495795 CTGGCTTTTACCTGAAGCTTTGG + Intronic
1015949423 6:138536624-138536646 TTTTTTTTCACTTTAAGCTCTGG + Intronic
1016905121 6:149140839-149140861 TTTCCTTGCACCTGAAGCCTTGG - Intergenic
1018100051 6:160429504-160429526 TTTACTTCCACCTGGGGCTCTGG - Intronic
1019569406 7:1703757-1703779 TTTGCTTTGGACTGAAACTCAGG - Intronic
1020554250 7:9650967-9650989 TTTTATTTTACCTTAAGCTCTGG + Intergenic
1021560485 7:21964588-21964610 TTTGTTTTCTCCTGGAGCTGGGG - Intergenic
1021617518 7:22518148-22518170 TATGCTTTCACCTGAACTTGGGG + Intronic
1022471205 7:30682719-30682741 TTTGCTGCCCCCTGCAGCTCGGG - Intronic
1022927109 7:35067631-35067653 TATGCTTTCACCTGAACTTGGGG + Intergenic
1023228055 7:37992557-37992579 TTTGCTTTCTGCTGATGCTATGG - Intronic
1024506893 7:50169355-50169377 TTTTCTTTCACCTATTGCTCTGG + Intergenic
1026406604 7:70072509-70072531 ATTACTTTCAGCTGAACCTCGGG - Intronic
1026653733 7:72238080-72238102 TTAGCTGTCACCTGGAGCTTTGG - Intronic
1027710441 7:81594328-81594350 TTTACTTGCAGCTGAATCTCTGG - Intergenic
1028375160 7:90137961-90137983 TATGCTTTCACCTGAAGTTGGGG - Intergenic
1028794623 7:94889230-94889252 TTTGCTTGCTCCTGAGGCTCTGG - Intergenic
1029503767 7:100949870-100949892 TTTCCCTGCACCTGGAGCTCTGG - Intronic
1030349246 7:108464730-108464752 TTTCCTTTCACCTAATGCTAAGG - Intergenic
1032803635 7:135335802-135335824 TTTTCTGTCACCTGAGGCTCTGG - Intergenic
1032832278 7:135640207-135640229 TTTTCTTTAACTTGAAGTTCTGG - Intronic
1033246084 7:139717354-139717376 GTTGCTTTCTACTGAAACTCAGG + Intronic
1033434465 7:141320543-141320565 CTTTCTGTCTCCTGAAGCTCAGG + Intronic
1037333806 8:17772330-17772352 CTTGTTTTCACCTGTAGCTTTGG - Intronic
1037500399 8:19480117-19480139 TTTGCTTTTATTTGAAGTTCAGG + Intronic
1038058005 8:23880299-23880321 TTTGCTCTCCCCTGAAGGGCAGG + Intergenic
1038705521 8:29889964-29889986 TTTGCTTTCACATGATGATAAGG - Intergenic
1041740326 8:61150741-61150763 TGTGGTTTCACTTGAAGCTGTGG + Intronic
1042845050 8:73161785-73161807 TTTATTTCCACATGAAGCTCTGG - Intergenic
1044795956 8:95897866-95897888 TTTGACTTCAGCTGTAGCTCTGG + Intergenic
1044933283 8:97270556-97270578 TTCACTTTCACCTGAAACTCTGG - Intergenic
1045130044 8:99140737-99140759 TTTGTTTACAACTGAAACTCTGG + Intronic
1045424917 8:102056280-102056302 TTTGCTTCTCCCTAAAGCTCAGG - Intronic
1047626949 8:126666189-126666211 CCTGAATTCACCTGAAGCTCTGG + Intergenic
1048124185 8:131614616-131614638 TTCCCTTTAACCTGTAGCTCAGG - Intergenic
1053336964 9:37283315-37283337 TTTGTTTTCTCCTGAAACTATGG - Intronic
1055226910 9:74008087-74008109 TTGGCCTTAATCTGAAGCTCTGG - Intergenic
1055562872 9:77538421-77538443 TTTGCTTCCACATGAAACTTGGG + Intronic
1055848731 9:80598993-80599015 TGTTCTTTCACCTGATTCTCAGG - Intergenic
1058265989 9:102899306-102899328 TTTGGTTTCACATGAAATTCTGG - Intergenic
1058569137 9:106322134-106322156 TTTGATTACTCCTGAGGCTCGGG + Intergenic
1061356226 9:130107239-130107261 TTTGTTTTCTCCTCACGCTCTGG + Intronic
1061568037 9:131457195-131457217 TTTGATTTCAGCTGAAGCTTTGG + Intronic
1203658987 Un_KI270753v1:23856-23878 GATGCTTTAACCTGCAGCTCGGG - Intergenic
1185527149 X:789015-789037 TCTGCTTCCACCTGGACCTCCGG - Intergenic
1187687943 X:21834848-21834870 TTCGCTTTCACCTTAAGAGCAGG - Intergenic
1188645252 X:32558626-32558648 TTTGCTTTTATGTGAAACTCTGG - Intronic
1189183170 X:39023494-39023516 TTTGCTCTCCCCTTAAGATCGGG - Intergenic
1189710213 X:43802928-43802950 TTTTCTTTTACTTTAAGCTCCGG - Intronic
1191892923 X:65963320-65963342 CTTGCTTTAACCTGATGTTCAGG + Intergenic
1194656569 X:96581008-96581030 TGTGTTCTCATCTGAAGCTCAGG + Intergenic
1196784230 X:119408107-119408129 TGGGCTTTCTCCTGTAGCTCAGG - Intronic
1197773499 X:130105689-130105711 CTTTCCTCCACCTGAAGCTCTGG + Intronic
1200535770 Y:4395595-4395617 TGTTCTTTCCCCTGAATCTCTGG - Intergenic
1201725202 Y:17142972-17142994 TGTGATTTCACCTGATGATCCGG + Intergenic