ID: 1074455048

View in Genome Browser
Species Human (GRCh38)
Location 10:113589163-113589185
Sequence AAGCACAGGGAGCATTTAAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 178}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074455034_1074455048 16 Left 1074455034 10:113589124-113589146 CCCCCACTCCCGGCCCCGGTTCC 0: 1
1: 0
2: 12
3: 122
4: 1308
Right 1074455048 10:113589163-113589185 AAGCACAGGGAGCATTTAACAGG 0: 1
1: 0
2: 0
3: 12
4: 178
1074455039_1074455048 8 Left 1074455039 10:113589132-113589154 CCCGGCCCCGGTTCCCACAGGAC 0: 1
1: 0
2: 1
3: 21
4: 282
Right 1074455048 10:113589163-113589185 AAGCACAGGGAGCATTTAACAGG 0: 1
1: 0
2: 0
3: 12
4: 178
1074455029_1074455048 22 Left 1074455029 10:113589118-113589140 CCCCCACCCCCACTCCCGGCCCC 0: 1
1: 3
2: 70
3: 724
4: 4502
Right 1074455048 10:113589163-113589185 AAGCACAGGGAGCATTTAACAGG 0: 1
1: 0
2: 0
3: 12
4: 178
1074455043_1074455048 1 Left 1074455043 10:113589139-113589161 CCGGTTCCCACAGGACACGCTAA 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1074455048 10:113589163-113589185 AAGCACAGGGAGCATTTAACAGG 0: 1
1: 0
2: 0
3: 12
4: 178
1074455044_1074455048 -5 Left 1074455044 10:113589145-113589167 CCCACAGGACACGCTAAGAAGCA 0: 1
1: 0
2: 1
3: 4
4: 75
Right 1074455048 10:113589163-113589185 AAGCACAGGGAGCATTTAACAGG 0: 1
1: 0
2: 0
3: 12
4: 178
1074455041_1074455048 3 Left 1074455041 10:113589137-113589159 CCCCGGTTCCCACAGGACACGCT 0: 1
1: 0
2: 0
3: 8
4: 83
Right 1074455048 10:113589163-113589185 AAGCACAGGGAGCATTTAACAGG 0: 1
1: 0
2: 0
3: 12
4: 178
1074455033_1074455048 19 Left 1074455033 10:113589121-113589143 CCACCCCCACTCCCGGCCCCGGT 0: 1
1: 0
2: 9
3: 149
4: 3360
Right 1074455048 10:113589163-113589185 AAGCACAGGGAGCATTTAACAGG 0: 1
1: 0
2: 0
3: 12
4: 178
1074455031_1074455048 20 Left 1074455031 10:113589120-113589142 CCCACCCCCACTCCCGGCCCCGG 0: 1
1: 0
2: 10
3: 190
4: 1603
Right 1074455048 10:113589163-113589185 AAGCACAGGGAGCATTTAACAGG 0: 1
1: 0
2: 0
3: 12
4: 178
1074455035_1074455048 15 Left 1074455035 10:113589125-113589147 CCCCACTCCCGGCCCCGGTTCCC 0: 1
1: 0
2: 3
3: 50
4: 557
Right 1074455048 10:113589163-113589185 AAGCACAGGGAGCATTTAACAGG 0: 1
1: 0
2: 0
3: 12
4: 178
1074455040_1074455048 7 Left 1074455040 10:113589133-113589155 CCGGCCCCGGTTCCCACAGGACA 0: 1
1: 0
2: 0
3: 21
4: 226
Right 1074455048 10:113589163-113589185 AAGCACAGGGAGCATTTAACAGG 0: 1
1: 0
2: 0
3: 12
4: 178
1074455045_1074455048 -6 Left 1074455045 10:113589146-113589168 CCACAGGACACGCTAAGAAGCAC 0: 1
1: 0
2: 0
3: 7
4: 100
Right 1074455048 10:113589163-113589185 AAGCACAGGGAGCATTTAACAGG 0: 1
1: 0
2: 0
3: 12
4: 178
1074455042_1074455048 2 Left 1074455042 10:113589138-113589160 CCCGGTTCCCACAGGACACGCTA 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1074455048 10:113589163-113589185 AAGCACAGGGAGCATTTAACAGG 0: 1
1: 0
2: 0
3: 12
4: 178
1074455036_1074455048 14 Left 1074455036 10:113589126-113589148 CCCACTCCCGGCCCCGGTTCCCA 0: 1
1: 0
2: 5
3: 45
4: 362
Right 1074455048 10:113589163-113589185 AAGCACAGGGAGCATTTAACAGG 0: 1
1: 0
2: 0
3: 12
4: 178
1074455037_1074455048 13 Left 1074455037 10:113589127-113589149 CCACTCCCGGCCCCGGTTCCCAC 0: 1
1: 0
2: 13
3: 103
4: 979
Right 1074455048 10:113589163-113589185 AAGCACAGGGAGCATTTAACAGG 0: 1
1: 0
2: 0
3: 12
4: 178
1074455030_1074455048 21 Left 1074455030 10:113589119-113589141 CCCCACCCCCACTCCCGGCCCCG 0: 1
1: 1
2: 28
3: 350
4: 2533
Right 1074455048 10:113589163-113589185 AAGCACAGGGAGCATTTAACAGG 0: 1
1: 0
2: 0
3: 12
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074455048 Original CRISPR AAGCACAGGGAGCATTTAAC AGG Exonic
903656307 1:24950684-24950706 AAGCACAGGGGGCCATGAACAGG + Intronic
904997764 1:34644325-34644347 AAGCTAGGAGAGCATTTAACAGG - Intergenic
914374264 1:147059731-147059753 AAGCACAGGGATCAGTTAATAGG + Intergenic
923904563 1:238369488-238369510 AAGTAAAGGGTGCCTTTAACAGG - Intergenic
924450685 1:244175994-244176016 AATCACAGGTAGCATTTTAAAGG + Intergenic
1064386903 10:14902952-14902974 AAGTACAGTGAGTATTAAACAGG - Intronic
1065517111 10:26534733-26534755 GAGCACAGTGAGCATTTCCCAGG + Intronic
1065523122 10:26591133-26591155 AAGCAAAGAGAGCAATTCACAGG - Intergenic
1065557873 10:26934670-26934692 AAGCAAAGAGAGCAATTCACAGG + Intergenic
1066494148 10:35925773-35925795 AATCACAGGTAGCATCTAAATGG + Intergenic
1066735230 10:38470484-38470506 AAGCAGAGGGAACATTTAGGAGG + Intergenic
1067321116 10:45222195-45222217 AAACACAGGGAACAATTAACTGG - Intergenic
1067354826 10:45514388-45514410 AAGCACAGGGACCATGTTGCGGG - Intronic
1067780530 10:49200791-49200813 AACCACAGGGAGAAATAAACAGG + Intergenic
1070614940 10:77962394-77962416 AAGCCTAGGGAGCATGTAGCCGG + Intergenic
1071138259 10:82477407-82477429 GAGCACAGGGACCCATTAACTGG + Intronic
1071417045 10:85451077-85451099 AAGCACACAGAGCACTTAATAGG + Intergenic
1071821342 10:89284362-89284384 AAGGACAGGCTGCATTTAGCTGG + Intronic
1073689201 10:105788560-105788582 AAGCACAGGAAGCAAAAAACAGG + Intergenic
1073974909 10:109089663-109089685 AAGGACAGGGACAATTTAAGAGG - Intergenic
1074244266 10:111671910-111671932 AAGCTCAGAGAACATTAAACAGG + Intergenic
1074455048 10:113589163-113589185 AAGCACAGGGAGCATTTAACAGG + Exonic
1074744993 10:116523566-116523588 AAGCACAGAGAGGAAGTAACAGG - Intergenic
1077880183 11:6343020-6343042 AAAGAGAGGGAGCATCTAACTGG + Intergenic
1080108108 11:28533187-28533209 AAGCAAAGGAAACATTTAAAAGG + Intergenic
1084343682 11:68527937-68527959 AAATACAGGGAGCATTTAGGAGG - Intronic
1084565199 11:69924613-69924635 AAGCAGAGGGAGCATGTGACAGG - Intergenic
1086805466 11:91236206-91236228 AAGTACAGGGTGTATTTGACAGG - Intergenic
1088866171 11:113850063-113850085 AAGCTGAGGTAGCATTTCACAGG + Intronic
1090128144 11:124111205-124111227 GAGCACAGGGATCAATTAAATGG + Intergenic
1090772544 11:129933968-129933990 AAGCACCGGAAGGATTGAACTGG - Intronic
1091803926 12:3342694-3342716 AAGCACAGGCAGCAAGTAAAGGG - Intergenic
1094047244 12:26180554-26180576 AAGCACAGGGGACAGTTAAGGGG - Intronic
1094742418 12:33304975-33304997 AAGCACTGGGAGCATTATCCTGG + Intergenic
1098480180 12:70948872-70948894 AAGCACAGGAGGCATTTAGAGGG + Intergenic
1100023712 12:90102056-90102078 AAGCAAAGGAAGCATTTCAAAGG - Intergenic
1103804438 12:123561436-123561458 AAGCACAGGTTGCATTAACCAGG - Intergenic
1104510907 12:129376933-129376955 AAGCAAAGGAAACATTTAATGGG - Intronic
1105061310 12:133153684-133153706 TGGCACAGGGATCATTTACCAGG + Intronic
1105767357 13:23575048-23575070 AAGAATGGGGGGCATTTAACAGG - Intronic
1106344029 13:28858784-28858806 AAGAACAGGGAAGATTTAGCTGG + Intronic
1106405207 13:29467409-29467431 AATCACAGGGAGCTATTATCTGG + Intronic
1107332708 13:39319115-39319137 CAGCAAAGAAAGCATTTAACTGG + Intergenic
1107783507 13:43930429-43930451 ATGCACACGGAACATTTACCAGG - Intergenic
1110561263 13:76912769-76912791 AAGCAAAGGGGGCTTTTAATGGG - Intergenic
1111916554 13:94366827-94366849 AATCAAAAGGAGCATTTACCAGG + Intronic
1113085054 13:106561210-106561232 AATCACTGGGAGCATATAAAAGG + Intronic
1116178595 14:41507135-41507157 AAGCACAGGGAGATTTTACCAGG - Intergenic
1120074254 14:80137810-80137832 AAGGCCAGGGAGCATGTAAAGGG - Intergenic
1120496515 14:85244004-85244026 AAACACAGGGCGCATTTATTGGG - Intergenic
1126361455 15:47850688-47850710 AATCACAGGGAGCATTTTTAAGG + Intergenic
1126949892 15:53869285-53869307 CAGGACAGGCAGCATTGAACAGG - Intergenic
1129235975 15:74224008-74224030 AACCTCAGGTAGCTTTTAACGGG - Intergenic
1135744263 16:25002730-25002752 AAGCAATGGGAGTATTAAACTGG + Intronic
1137490033 16:48924698-48924720 ATGCACAGGGAACAATTACCAGG + Intergenic
1138041544 16:53675808-53675830 AAGCAAATGTAGAATTTAACAGG + Intronic
1141267611 16:82511190-82511212 AAGCACAGGGTGCTTGTAAGGGG - Intergenic
1141743666 16:85911661-85911683 AAGCAGAGGCAGCATTTCAGGGG + Intronic
1142112712 16:88340799-88340821 ATGCACAGGGAGGAGTTTACAGG + Intergenic
1143031334 17:3969018-3969040 GAGCACAGTGAGCACTTTACGGG - Intergenic
1143949728 17:10623063-10623085 AAGCAGAGGGAGCCCTCAACAGG - Intergenic
1148674161 17:49435316-49435338 AGGGACAGGGAGCATTCAGCAGG + Intronic
1149463384 17:56852654-56852676 AAGCACAGGAACCATTTTAAAGG - Intronic
1151886911 17:76928276-76928298 AAGCACAGGGAGCAGATTTCTGG + Intronic
1153692010 18:7603433-7603455 AAGCCCAGGTAGCTGTTAACAGG - Intronic
1155074886 18:22345967-22345989 GAGCACAGGGAGCATGTACTGGG + Intergenic
1157492691 18:48135649-48135671 AAGCCCAGAGAGGATTTAACTGG + Intronic
1161390520 19:4018120-4018142 AAACACAGGGAGTTTTTAAAAGG - Intronic
1161619628 19:5291265-5291287 AAACACAGAGAACATTTAATGGG - Intronic
1164833983 19:31345325-31345347 AAGCACATGGAGCATTCAGAAGG - Intronic
925273366 2:2631210-2631232 AAGGACTGGGAGCAGATAACTGG - Intergenic
925683581 2:6448505-6448527 CAGCACAGGGAGCAGTTCATAGG + Intergenic
926056626 2:9777588-9777610 AAGGGCAGGGTGCATTTAAAAGG - Intergenic
926871953 2:17430140-17430162 GAGCACAGAGAGCTTTTAAAAGG - Intergenic
927819117 2:26246733-26246755 AAGCACAGGGAGCAAAAAAATGG - Intronic
935096963 2:99953980-99954002 AAGCACAGAGAGCCTGTATCTGG + Intronic
936576938 2:113665101-113665123 AAGGACAAGGAGCATTTATGGGG + Intergenic
936682626 2:114791733-114791755 AAGGACAGTGAGTATTTAAGTGG + Intronic
937384662 2:121417611-121417633 AATCACAGGGACCATCTAGCAGG + Intronic
938603211 2:132864552-132864574 AAGCACAGGGGGAATTTATCAGG - Intronic
938918167 2:135964886-135964908 AAGCACAGTAAACATTTAAAGGG - Intronic
944990943 2:205234748-205234770 GAGCACATAGAACATTTAACAGG + Intronic
945000072 2:205340096-205340118 GAGCTTAGAGAGCATTTAACAGG - Intronic
1170980869 20:21211640-21211662 AAGCTCAGAGAACAGTTAACAGG - Intronic
1171506051 20:25634531-25634553 AAGCCCAGGTAGCAATTATCAGG - Intergenic
1172110401 20:32541424-32541446 AAACTCAGGGAGCACTTGACTGG - Intronic
1172622660 20:36329933-36329955 AAGCAGAGGAATCACTTAACCGG + Intronic
1174298132 20:49563155-49563177 AAGCTCTGGGAGGATTTAATGGG + Intronic
1175818628 20:61896581-61896603 GAGCCCGAGGAGCATTTAACCGG + Intronic
1176083314 20:63284718-63284740 AAGCGCAGGGAGCAGGAAACGGG - Intronic
1177422144 21:20873647-20873669 AAGCACTGGAATCAGTTAACTGG - Intergenic
1178269479 21:31176767-31176789 AAGGACAGGGAGCAGTAACCAGG + Intronic
1178272534 21:31205056-31205078 AAGCCCAGGGAACATAAAACAGG + Intronic
1185423301 22:50747573-50747595 AAGGACAAGGAGCATTTATGGGG - Intergenic
950181514 3:10916878-10916900 AAGTAGAGAGAGCATTGAACTGG - Intronic
954668213 3:52271760-52271782 AAGCAAAGGAACTATTTAACTGG - Intronic
955104912 3:55888643-55888665 AATCACAGGGATCCTTGAACTGG + Intronic
955775984 3:62433552-62433574 AGGCCCAGGGAACATTTGACTGG - Intronic
955808874 3:62765028-62765050 AAACACAGAGAGTATTTACCTGG + Intronic
956665031 3:71633899-71633921 CAGCTCAGGAAACATTTAACAGG + Intergenic
958704518 3:97637680-97637702 AAGAAAAGGGAAAATTTAACTGG - Intronic
964263966 3:154873498-154873520 AAGCTCAGAGACCATTAAACAGG + Intergenic
967724393 3:192848234-192848256 AAGCAGAGTAGGCATTTAACTGG - Intronic
970019094 4:11546896-11546918 AAGCACATGGAGCATTGCAAAGG + Intergenic
970433273 4:16008392-16008414 AAGCTCTGGGAGCAATTCACTGG + Intronic
971271091 4:25146656-25146678 AAACACAGAAAGCATTTAAAAGG + Intronic
972103836 4:35457479-35457501 AAGCACAGGGAGGAGTTAGAGGG + Intergenic
976046344 4:80952832-80952854 AAGCAGAGGTGGCATTAAACAGG - Intronic
977784840 4:101020864-101020886 AAGAACAGGTAACATTGAACTGG + Intergenic
978775914 4:112506750-112506772 AAGCAGAGGCAGCAATTACCTGG + Intergenic
979261583 4:118653424-118653446 AAGCAGAGGGAACATTTAGGAGG + Intergenic
980291450 4:130851237-130851259 AAGCACAGAGGGCAGTGAACAGG - Intergenic
982021899 4:151213205-151213227 AAGCAGTGGTAGGATTTAACAGG + Intronic
983150250 4:164269909-164269931 AAGCAGAGGGAACATTTAGGAGG - Intronic
983842372 4:172473065-172473087 AAGTACAGGAAGCAATTATCAGG - Intronic
984396134 4:179202195-179202217 AAGCAGACTGAGCATTAAACAGG - Intergenic
984488065 4:180397920-180397942 AGGCACAGGGAACATTAAAAGGG - Intergenic
984544971 4:181090652-181090674 AAGCAGAGGCAGCATTTGAAAGG - Intergenic
985164671 4:187079956-187079978 AAGCACAGGCAGCATTCACAAGG - Intergenic
986578855 5:9243039-9243061 ACGCCCAGTGAGCATTCAACAGG - Intronic
986679284 5:10218779-10218801 AAGCACAGCTAGCAGTTAGCAGG - Intergenic
986805518 5:11305238-11305260 TGGCACAGGAAGCATTTAAGTGG + Intronic
988149761 5:27362792-27362814 CAACACATGGAGCTTTTAACAGG - Intergenic
994993300 5:107026627-107026649 AGGCACAAGGAGAATTTAAATGG + Intergenic
995397907 5:111707818-111707840 AAGCACAGTCAGCATTTATTTGG + Intronic
996983508 5:129530476-129530498 GAGCAGAGGGAACATTGAACAGG + Intronic
1000961607 5:167607422-167607444 CAAAACAGGGAGCATTTCACAGG + Intronic
1004584874 6:16989630-16989652 AAGCACAGGGAGGAAATAAATGG + Intergenic
1005797005 6:29374948-29374970 AAGCACAGAGGCCATTTTACTGG - Exonic
1006781450 6:36635227-36635249 AAGAACAGGGAGGAATTAACCGG - Intergenic
1007014138 6:38446246-38446268 AAGTACAGGGTGCATTTAAAGGG - Intronic
1007285418 6:40744126-40744148 GAGCACAGGGAGCATGGAACTGG + Intergenic
1008283112 6:49619470-49619492 AGGAAAAGAGAGCATTTAACTGG + Intronic
1008316568 6:50049291-50049313 AAGAAAAAGGAGAATTTAACTGG + Intergenic
1009284378 6:61797385-61797407 GATCACAGAGAGCCTTTAACTGG + Intronic
1010181085 6:73087172-73087194 AAGCAGAGAGAGCAATTAAGAGG + Intronic
1010903041 6:81451379-81451401 AAGCGCAAGGAGACTTTAACAGG - Intergenic
1011787819 6:90866399-90866421 TAGCAAGGGGGGCATTTAACTGG - Intergenic
1012157648 6:95840151-95840173 AAGCACAGGGAGCAGTTAGTGGG - Intergenic
1013335944 6:109161391-109161413 AAGCAGAGGGAGCCTTTCCCAGG + Intronic
1016823859 6:148370482-148370504 AAGCAAAGAGAGAATTTAATAGG - Intronic
1018482681 6:164207537-164207559 AAGCACAGGGTGCTCTTAAAAGG + Intergenic
1018651818 6:165998771-165998793 AAGCACAAGGAGGCTTTCACAGG - Intergenic
1019835457 7:3378760-3378782 AAGGGCAGGGAGCATATAGCGGG + Intronic
1020142632 7:5620921-5620943 AAGCACAGGGAGCATATTTAAGG + Intronic
1023307384 7:38845041-38845063 AAGCACAGGGAGGATTTGAAGGG + Intronic
1023518933 7:41031546-41031568 AAGCACAGGGAGCCAATGACGGG - Intergenic
1025015969 7:55439407-55439429 CAGCACAGGCAGCACTTGACAGG + Intronic
1025720153 7:64002965-64002987 AAGCACAGTCAGCATTTACAGGG + Intergenic
1029173247 7:98645529-98645551 AAGCTGGGGGAGCATCTAACAGG + Intergenic
1029521576 7:101066208-101066230 AAGGACAGGGTGAATGTAACAGG - Intergenic
1031151569 7:118059985-118060007 ATGCAGAGGGGGCATTTAAATGG - Intergenic
1035114529 7:156513208-156513230 ACACACAGGGAACATTCAACAGG + Intergenic
1035991091 8:4490969-4490991 AACCACAGGGAGGAGTTCACAGG + Intronic
1036079429 8:5538449-5538471 AGGCCCAGGGAGCATTCATCTGG - Intergenic
1037041245 8:14237606-14237628 AATCACATGGGGCAGTTAACCGG - Exonic
1037962102 8:23105404-23105426 AAGCTCAGGGAGCAAGTACCAGG - Intronic
1038951321 8:32417381-32417403 AGGTACAGGGAGCATCTAAATGG + Intronic
1043391703 8:79798309-79798331 AAGCACAGCCAGCATTTCAGGGG + Intergenic
1043600332 8:81929385-81929407 AAGTACAGGGAGAATTAAAGGGG + Intergenic
1043859282 8:85297440-85297462 AAGGAGAAGGAGTATTTAACAGG + Intergenic
1044680374 8:94771768-94771790 AAACACAGGGAGCATGTGGCAGG + Intronic
1046525298 8:115375370-115375392 AAATCCAGGGAGCATTTAGCTGG + Intergenic
1047178740 8:122567261-122567283 GATCACAGGGAGCATTTTAAGGG + Intergenic
1048102734 8:131371830-131371852 ATGCACATGGAGCATTCACCTGG + Intergenic
1048536636 8:135302479-135302501 ATGCAGAGAGAGCATTTAAGAGG - Intergenic
1050707520 9:8419721-8419743 AAGCTGTGGGAGCAGTTAACAGG - Intronic
1050844181 9:10193140-10193162 AAGACCAGAGATCATTTAACGGG - Intronic
1056608277 9:88105800-88105822 AAGCACATGGGGCATTTTCCAGG - Intergenic
1057591595 9:96377814-96377836 AAGCTCAGGCAGCATTCCACAGG + Intronic
1057738379 9:97688870-97688892 AAGCACAGGGAACAGGTAAGAGG + Intronic
1058115165 9:101077150-101077172 AAGCAGAGGCAGCATTTATTTGG - Intronic
1058592089 9:106576169-106576191 GAGCACAGGGAGGATTTAATAGG + Intergenic
1058768965 9:108211891-108211913 AATCAAAGGGAGCATTTGCCTGG + Intergenic
1059267069 9:113044529-113044551 AAACACAGGGAGAAGTGAACAGG + Intronic
1059712593 9:116883342-116883364 AGGAAGAGGTAGCATTTAACTGG + Intronic
1186265225 X:7825277-7825299 AAGCACAGGGAGTATTCACTTGG - Intergenic
1187116430 X:16356927-16356949 AAGGAAAGGGAGCATATAAGAGG - Intergenic
1187522173 X:20023391-20023413 AAGCCCAGGCAACATTTAAGGGG + Intronic
1193950458 X:87790969-87790991 AAATACATGGAGCAATTAACCGG - Intergenic
1195674406 X:107496918-107496940 AAACACAGGGTGGATTTACCAGG + Intergenic
1197632787 X:128881426-128881448 AAGCATAGAGACCATTTAAGAGG - Intergenic
1197756890 X:130001924-130001946 AGGCAGAGGGAGCAGTTAAGAGG + Intronic
1198512189 X:137363528-137363550 AAGCACAGGGAACATAGAAGTGG - Intergenic
1199318929 X:146415409-146415431 GAGTACAGGGAGCATTTGAGTGG + Intergenic
1199391845 X:147289262-147289284 CAGCAGAGGGAGCATTTGAGAGG - Intergenic
1200694324 Y:6345139-6345161 AAGCAGCTGTAGCATTTAACAGG - Intergenic
1201040953 Y:9829577-9829599 AAGCAGCTGTAGCATTTAACAGG + Intergenic
1201650997 Y:16286390-16286412 CAGAACATGCAGCATTTAACAGG - Intergenic
1202383668 Y:24301883-24301905 AAGCAGAGGGAACATTTAGGAGG + Intergenic
1202487115 Y:25368237-25368259 AAGCAGAGGGAACATTTAGGAGG - Intergenic