ID: 1074456638

View in Genome Browser
Species Human (GRCh38)
Location 10:113601256-113601278
Sequence AAAGCTCTGGGTAGGGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 272}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074456638_1074456652 25 Left 1074456638 10:113601256-113601278 CCTCTGGCCCTACCCAGAGCTTT 0: 1
1: 0
2: 1
3: 22
4: 272
Right 1074456652 10:113601304-113601326 CAGGAGAAGCAGCTGAAGGCTGG No data
1074456638_1074456651 21 Left 1074456638 10:113601256-113601278 CCTCTGGCCCTACCCAGAGCTTT 0: 1
1: 0
2: 1
3: 22
4: 272
Right 1074456651 10:113601300-113601322 AAGTCAGGAGAAGCAGCTGAAGG No data
1074456638_1074456644 -10 Left 1074456638 10:113601256-113601278 CCTCTGGCCCTACCCAGAGCTTT 0: 1
1: 0
2: 1
3: 22
4: 272
Right 1074456644 10:113601269-113601291 CCAGAGCTTTCTCTCTGGCCTGG No data
1074456638_1074456654 27 Left 1074456638 10:113601256-113601278 CCTCTGGCCCTACCCAGAGCTTT 0: 1
1: 0
2: 1
3: 22
4: 272
Right 1074456654 10:113601306-113601328 GGAGAAGCAGCTGAAGGCTGGGG No data
1074456638_1074456653 26 Left 1074456638 10:113601256-113601278 CCTCTGGCCCTACCCAGAGCTTT 0: 1
1: 0
2: 1
3: 22
4: 272
Right 1074456653 10:113601305-113601327 AGGAGAAGCAGCTGAAGGCTGGG No data
1074456638_1074456647 -5 Left 1074456638 10:113601256-113601278 CCTCTGGCCCTACCCAGAGCTTT 0: 1
1: 0
2: 1
3: 22
4: 272
Right 1074456647 10:113601274-113601296 GCTTTCTCTCTGGCCTGGGGAGG No data
1074456638_1074456649 6 Left 1074456638 10:113601256-113601278 CCTCTGGCCCTACCCAGAGCTTT 0: 1
1: 0
2: 1
3: 22
4: 272
Right 1074456649 10:113601285-113601307 GGCCTGGGGAGGGCAAAGTCAGG No data
1074456638_1074456646 -8 Left 1074456638 10:113601256-113601278 CCTCTGGCCCTACCCAGAGCTTT 0: 1
1: 0
2: 1
3: 22
4: 272
Right 1074456646 10:113601271-113601293 AGAGCTTTCTCTCTGGCCTGGGG No data
1074456638_1074456648 -4 Left 1074456638 10:113601256-113601278 CCTCTGGCCCTACCCAGAGCTTT 0: 1
1: 0
2: 1
3: 22
4: 272
Right 1074456648 10:113601275-113601297 CTTTCTCTCTGGCCTGGGGAGGG No data
1074456638_1074456645 -9 Left 1074456638 10:113601256-113601278 CCTCTGGCCCTACCCAGAGCTTT 0: 1
1: 0
2: 1
3: 22
4: 272
Right 1074456645 10:113601270-113601292 CAGAGCTTTCTCTCTGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074456638 Original CRISPR AAAGCTCTGGGTAGGGCCAG AGG (reversed) Intronic
900730933 1:4259214-4259236 TAAGATTTGGGGAGGGCCAGGGG + Intergenic
900972892 1:6001230-6001252 AGGGCTCAGGGTAGGGCCTGGGG - Intronic
901201817 1:7471545-7471567 AATGCACTGGGTAGGCTCAGGGG - Intronic
901662372 1:10806579-10806601 AGAGCCCTGGCTGGGGCCAGAGG - Intergenic
901878297 1:12179529-12179551 AAAGCTGTGGGGAGGGGCAGAGG - Intronic
902571977 1:17352745-17352767 AAAGTTCTGTTTAGGGCAAGTGG + Intronic
902989235 1:20174597-20174619 AGAGCTCTGGGCAGGACCAACGG + Intronic
904957620 1:34298317-34298339 AAAGCCCTAGGTAAGTCCAGGGG - Intergenic
905024893 1:34843277-34843299 AAAGCTGGGGGTGGGTCCAGAGG + Intronic
905957335 1:42009433-42009455 AATCCTGTGGGTAGAGCCAGAGG - Intronic
908174284 1:61538806-61538828 GAAGCTCTGGGTAGGGGTAAAGG + Intergenic
909574668 1:77159954-77159976 GGAGCTCTGGGAGGGGCCAGAGG + Intronic
910058048 1:83055470-83055492 GAAGATGTGGGTGGGGCCAGTGG - Intergenic
913063776 1:115231319-115231341 AAAGTTCTGGGTTGGGGGAGTGG - Intergenic
913445430 1:118945536-118945558 GGAGCTCTGGTTAGGGACAGTGG - Intronic
915385357 1:155486876-155486898 AAAGCTCTGGCTGGGCACAGTGG + Intronic
915765032 1:158354102-158354124 GAAGCTCTGGGGAGGTCCTGGGG + Intronic
918665531 1:187146391-187146413 AAACTTCTGGGTGGGGGCAGTGG - Intergenic
920037036 1:203072890-203072912 ACAGCTCTGGGTCGGGGGAGGGG - Intronic
921880319 1:220248489-220248511 AAAGCTAGGGGTAGGGGTAGGGG + Intronic
922291300 1:224210943-224210965 AAGGCTCTGGAAAGGGCCAAGGG - Intergenic
922360063 1:224812886-224812908 TAAGCTCTGAGCAGGGGCAGAGG - Intergenic
922642075 1:227244582-227244604 AAAAATCTGGCTATGGCCAGGGG + Intronic
1063961687 10:11311183-11311205 ATAGTGCTGGGTAGGGCCAGGGG + Intronic
1065042578 10:21712597-21712619 AGAGCTCTTGGGAGGGCAAGAGG - Intronic
1065198799 10:23293911-23293933 GTAGCTCTGGGTTGGGCCTGAGG - Intronic
1065214458 10:23437363-23437385 AAAGCCCTGGCTAGGGTCAAGGG + Intergenic
1065979229 10:30875133-30875155 TGAGCTCTGGGTAGGGCCAAGGG + Intronic
1066006197 10:31148124-31148146 AAAGCTCGGGGTAGTGGTAGTGG + Intergenic
1067697230 10:48544136-48544158 AAAGGACTGGGTGGGGTCAGGGG + Intronic
1067941285 10:50659280-50659302 AGAGCTCAGGGAAGAGCCAGTGG - Intergenic
1068454729 10:57239299-57239321 AGAGATATGGGTAGGGCCAGTGG + Intergenic
1069939875 10:71948052-71948074 AAAGCCCTTGGAGGGGCCAGTGG + Intergenic
1070772063 10:79088330-79088352 AACTCCCTGGGCAGGGCCAGGGG + Intronic
1070862504 10:79684151-79684173 AGAGCTCAGGGAAGAGCCAGTGG - Intergenic
1072724582 10:97804331-97804353 AAAGCTCTGGAAATGGACAGTGG - Intergenic
1073075877 10:100825736-100825758 AGAGCTTGGGGTAGGGGCAGCGG + Intronic
1074456638 10:113601256-113601278 AAAGCTCTGGGTAGGGCCAGAGG - Intronic
1074844910 10:117389180-117389202 TAAGCCTTGGTTAGGGCCAGGGG - Intergenic
1075386925 10:122061688-122061710 CAAGCTCTGGGCTGGACCAGAGG + Intronic
1075591096 10:123692311-123692333 CAAGCTCTGGGTAGTGGCAGAGG - Exonic
1075671214 10:124265248-124265270 ACAGCCCTGGGTAGGGCGAGTGG - Intergenic
1076002109 10:126920446-126920468 AAAGCTCTGGGGAGCCCCACTGG - Intronic
1076087466 10:127647792-127647814 AAAGGTATGGTTAGGGCTAGAGG - Intergenic
1076284404 10:129278820-129278842 AAGGCTCTGGGGAGGGCAGGAGG + Intergenic
1076738186 10:132468008-132468030 AAGGTGCTGGGTGGGGCCAGGGG + Intergenic
1076934831 10:133560359-133560381 AAAACTCTGGGTGAGGGCAGGGG + Intronic
1077321140 11:1942602-1942624 ACAGCTCTGGGGAGGGCCGCAGG + Intergenic
1077369469 11:2174704-2174726 ACATCTCTGGAGAGGGCCAGAGG - Intergenic
1077636449 11:3844812-3844834 ACAGGTATGGGAAGGGCCAGAGG + Intergenic
1078060653 11:8040521-8040543 GAAGCTCTGTGGAGAGCCAGGGG + Intronic
1078544698 11:12238912-12238934 AAAGCTGGGGGTAGGTACAGAGG + Intronic
1078766882 11:14306736-14306758 AAAGCTCAGGGTAGGGAATGGGG - Intronic
1083193125 11:61066742-61066764 AAAGCTCTGGGGAGGACCTCTGG - Intergenic
1083324252 11:61865516-61865538 TAAGCCCTGGTTAGGGCCAAGGG + Intronic
1083893166 11:65607022-65607044 AAAGTTCTGGGAAGGTCTAGTGG - Intronic
1084483754 11:69436442-69436464 ACAGCTAAGGGCAGGGCCAGAGG + Intergenic
1084659548 11:70538788-70538810 AAAGCACTGGGTGGGGCGGGAGG + Intronic
1086685625 11:89730401-89730423 GAAGCACTGGGTAGGACCGGAGG - Intergenic
1086701086 11:89901047-89901069 GAGGCTCTGGGTTGGGCGAGCGG + Intergenic
1086705081 11:89943480-89943502 GAGGCTCTGGGTTGGGCGAGCGG - Intergenic
1087177278 11:95107352-95107374 AAAGGTCTGGGTGAGGCCTGAGG + Intronic
1087427425 11:98008012-98008034 AAAGCTGTGGGTTGGGGAAGAGG - Intergenic
1087602919 11:100339030-100339052 CAAGCTCTGTGCAGGGCCTGCGG + Intronic
1087669083 11:101083942-101083964 TAAGCTTTGGGAGGGGCCAGGGG + Intronic
1089692530 11:120195748-120195770 TTACCTCTGGGGAGGGCCAGAGG - Intergenic
1090293409 11:125566305-125566327 CAAGCTCTGTGTGGGGCCTGTGG + Intergenic
1091694261 12:2617370-2617392 TAAGCTATAGGGAGGGCCAGGGG + Intronic
1091995234 12:4987968-4987990 AATGGTCTGGGTGGGGCCCGAGG + Intergenic
1095825504 12:46526365-46526387 AAAGCTCTGAGTAGGCGCACAGG + Intergenic
1095825515 12:46526429-46526451 AGAGCAGGGGGTAGGGCCAGCGG - Intergenic
1095909376 12:47410467-47410489 AAATGTCTGGGTAGGGTGAGGGG - Intergenic
1096387491 12:51204426-51204448 AAAGCTCTGGGTATGGTTTGGGG + Intronic
1098142844 12:67468825-67468847 CAAGCCCTGGGTGGGTCCAGAGG + Intergenic
1101139001 12:101775859-101775881 AAAGCTCTGGTCAGGGCCTAAGG - Intronic
1102459621 12:113092465-113092487 AAAGCTCTTTTGAGGGCCAGAGG + Intronic
1103493245 12:121340027-121340049 AAAGCTCTGGCCAGGCGCAGTGG + Intronic
1104103076 12:125634028-125634050 CAGGATCTGGGTAGGTCCAGAGG + Intronic
1104400417 12:128471485-128471507 AGAGCTATGCCTAGGGCCAGGGG - Intronic
1105255221 13:18739753-18739775 AAAGGTGTGGGCAGGGCCAAGGG - Intergenic
1106860692 13:33904460-33904482 AAGGCTCTGAGATGGGCCAGTGG - Intronic
1106931626 13:34672038-34672060 AAAGCTGGGGGTAGGGGAAGAGG - Intergenic
1107058239 13:36129797-36129819 AAAGCTCTGATGAGAGCCAGTGG - Intronic
1108690096 13:52851642-52851664 AAAGGTCTGGGCAGGCCCAAAGG + Intergenic
1108884715 13:55165621-55165643 AAAGCACTGTGTTGGGGCAGTGG - Intergenic
1110890059 13:80688154-80688176 TAAGCTTTGGGAGGGGCCAGAGG - Intergenic
1111402903 13:87764479-87764501 AAATCTCCGGACAGGGCCAGTGG + Intergenic
1112714969 13:102173809-102173831 AAAGCTGAGGGTAGGGGTAGGGG + Intronic
1113889129 13:113726745-113726767 AAGGCTCTGGGTGGGTCTAGAGG + Intronic
1114482241 14:23043056-23043078 AGAGCTCTCTGTGGGGCCAGGGG + Exonic
1114492332 14:23111076-23111098 AAGGCTCTGGGTATGGCCCTGGG - Intergenic
1114643585 14:24241113-24241135 GAAGCTGTGGGCAGGGACAGAGG + Exonic
1116854348 14:49938525-49938547 TAAGATCTGGGCGGGGCCAGGGG + Intergenic
1118500977 14:66362336-66362358 AAAGCTCTGCCCAGGGCCACAGG + Intergenic
1121273491 14:92652599-92652621 AGAGCTCTGGGAATGGGCAGTGG - Exonic
1123035807 14:105471469-105471491 ACAGCTCTGGGGAGAGACAGAGG - Intergenic
1126689291 15:51275372-51275394 AAAGCTCTGAGTAGGGCTGGAGG - Intronic
1127886992 15:63210247-63210269 ACAGCTCTAGAGAGGGCCAGAGG - Intronic
1129156508 15:73721617-73721639 AGAGGCCTGGCTAGGGCCAGGGG - Intergenic
1129737530 15:77974542-77974564 GCAGCTCTGGGCAGGGCCAGGGG + Intergenic
1129848536 15:78779077-78779099 GCAGCTCTGGGCAGGGCCGGGGG - Intronic
1130223864 15:82043889-82043911 AAAGCTCAGGGCGGGGCTAGGGG + Exonic
1131372018 15:91890474-91890496 AGAGCTCTGGGTGAGGCCACTGG - Intronic
1131724672 15:95208037-95208059 TAAGATTTGGGCAGGGCCAGGGG + Intergenic
1132142161 15:99405174-99405196 AAAGATCAGGGTAGGGGCAGTGG + Intergenic
1132282926 15:100635677-100635699 TAAGGTGTGGGGAGGGCCAGTGG + Intronic
1132939250 16:2498832-2498854 GGAGCTCTGGGTTGGGCCTGGGG + Intronic
1135235192 16:20748762-20748784 AAAGCTCTGGCTGGAGGCAGTGG + Intronic
1135379794 16:21986105-21986127 AACGCTCTGGGTAGGCCAAGTGG - Intronic
1136040960 16:27578502-27578524 AAAGCTCCAGGGAGTGCCAGAGG + Intronic
1136383952 16:29911261-29911283 AAAGCCCTGGGCAGGAGCAGAGG - Intronic
1138213220 16:55180430-55180452 ATGGCTCTGGGTGGTGCCAGTGG - Intergenic
1138390169 16:56664619-56664641 CCAGCTGTGGGCAGGGCCAGAGG + Intronic
1139587535 16:67913771-67913793 ATAGGTCTAGGTAGGGCCTGAGG + Intronic
1140902198 16:79379436-79379458 TAAGATCTGGGCAGGGTCAGAGG + Intergenic
1141173145 16:81703831-81703853 ACAGCTCTCTGTAGGGCGAGGGG + Intronic
1141550950 16:84806447-84806469 GAAGCTCTGGCCAGGCCCAGGGG - Intergenic
1142225842 16:88877270-88877292 GCAGCTCTGGGTGGGGGCAGAGG + Exonic
1144658228 17:17051670-17051692 AGAGCTCTGGGTAGGGCATGGGG - Intronic
1146999029 17:37347006-37347028 TGAGATCTGGGAAGGGCCAGCGG + Intronic
1150617232 17:66781748-66781770 AAAGTTCTGGAGATGGCCAGTGG + Intronic
1152298880 17:79484139-79484161 AAATTTCTGGGTGGTGCCAGTGG - Intronic
1152404354 17:80087967-80087989 ACAGCTGTGGGGAGGGCCATGGG - Intronic
1152563669 17:81090827-81090849 ACAGCCCTGGGTGGGGCAAGGGG - Intronic
1153175384 18:2366358-2366380 TGAGCTCTGGGTAGGTACAGTGG - Intergenic
1153301341 18:3594624-3594646 AAACCTCTGGGTTGGGGCTGGGG + Intronic
1153942804 18:9991956-9991978 CAAGTTCTGGATAGGGCCACTGG - Intergenic
1155061313 18:22231446-22231468 AAAGCTCTGGCCAGGCACAGTGG + Intergenic
1155129986 18:22924412-22924434 AAAGCTTTGGCTGGGGGCAGTGG - Intronic
1159584963 18:70275078-70275100 AAAGAGCAGGGTGGGGCCAGTGG - Intergenic
1161431328 19:4233915-4233937 CAAGCTCTGGCTAGGCTCAGTGG + Intronic
1162873279 19:13601649-13601671 AAAGTGCTGGGAAGGGCCAAAGG + Intronic
1163179895 19:15591943-15591965 AAAGGTGTGGGCAGGGCCAAGGG + Intergenic
1163438518 19:17309809-17309831 GAAGCTCTCGGTAGGGTCCGGGG - Intronic
1165502349 19:36199945-36199967 AAAGTTCTGGCCAGGCCCAGTGG - Intronic
1166159123 19:40938503-40938525 AAAGCCCTGGGTGGGCACAGTGG - Intergenic
1166168069 19:41006439-41006461 AAAGCCCTGGGTGGGCACAGGGG - Intronic
1166209886 19:41299575-41299597 AAATCTCTGGCTAGTGCCAAAGG - Intronic
1166341205 19:42138357-42138379 AAAGATCAGGGTAGGACCTGAGG + Intronic
1166737945 19:45097224-45097246 TAAGCTGTGGGGAGGGACAGGGG + Intronic
1168038665 19:53740459-53740481 TAAGGACTGGGGAGGGCCAGAGG - Intergenic
1168567230 19:57435397-57435419 AGAGCTCTGGGTCGGGACTGAGG + Exonic
925048206 2:790286-790308 AAAGCTCTGGGCTCAGCCAGAGG + Intergenic
926721008 2:15960081-15960103 AAAGCTCTGGGTGAGGTTAGAGG - Intergenic
927108878 2:19850220-19850242 AAAGCCCTGGGCAGGGCCCCAGG + Intergenic
927199567 2:20569973-20569995 AAAGCCCTGGGCAGGGCTGGGGG - Intronic
927845123 2:26467410-26467432 AGAGCTCTGGCTCTGGCCAGGGG - Exonic
929975588 2:46631354-46631376 AAAACTCTGGGTAAGCCCACAGG + Intergenic
930154459 2:48092044-48092066 TTACCACTGGGTAGGGCCAGAGG + Intergenic
930199818 2:48542270-48542292 AAAGCTCTTAAAAGGGCCAGAGG - Intronic
931903825 2:66821201-66821223 AGACCTCTTGGTTGGGCCAGAGG - Intergenic
932894574 2:75626492-75626514 AAAGCAGTGGGTAGGTCCTGAGG - Intergenic
933841810 2:86292920-86292942 AAAGCCCTGGGGAAGGCCATGGG + Intronic
936033012 2:109087163-109087185 AAGGCTCTGGTCAGGGCCATGGG + Intergenic
937150482 2:119682724-119682746 ACAGCTCTGGATGGCGCCAGTGG - Intronic
938173138 2:129100822-129100844 AAAGATCTGGGCAGGGACAAGGG - Intergenic
939157755 2:138544907-138544929 AAAGCTATGGGTATGCCCAGGGG - Intronic
939170551 2:138690169-138690191 GAGGCTCTGGGTTGAGCCAGTGG - Intronic
941450925 2:165659145-165659167 AAAGTTATGGGTAGGGTAAGTGG + Intronic
941932458 2:170955720-170955742 AAAGCCCTGATTAGGGCCAGTGG - Intronic
941977852 2:171424845-171424867 TGAGCTCTGGGAGGGGCCAGGGG + Intronic
942245829 2:174006850-174006872 AAAAATCTGGCTAGGCCCAGTGG - Intergenic
944691125 2:202159444-202159466 GAAGCCCTGGGTGGGGCAAGGGG + Intronic
946145666 2:217729124-217729146 AAAGCTCTGGCTGGGTGCAGTGG - Intronic
946842491 2:223832444-223832466 AGACCTGTGGGAAGGGCCAGTGG + Intronic
947518736 2:230828480-230828502 TGAGCCCTGGGTGGGGCCAGGGG - Intergenic
947962514 2:234251560-234251582 TCAGCTCTTGATAGGGCCAGGGG - Intergenic
948016640 2:234696620-234696642 TAAGATCTGGGAGGGGCCAGGGG - Intergenic
1168913589 20:1468804-1468826 AAAGCTCTTTGTTCGGCCAGAGG + Intronic
1168951149 20:1803159-1803181 AAAGCTCTGGAAAGGGCCAACGG + Intergenic
1169037778 20:2467810-2467832 GAAGTTTTGGGGAGGGCCAGAGG - Intronic
1169250021 20:4053007-4053029 AAAGTTATGGGAAGGGACAGGGG - Intergenic
1170848274 20:19980796-19980818 AAGGCTGTGGGTAGGACCTGAGG - Intronic
1172014036 20:31862535-31862557 CAAGGGCTGGGTTGGGCCAGGGG - Intronic
1172586026 20:36085510-36085532 AAACCACTGGGAAGGGACAGAGG + Intergenic
1174775022 20:53335427-53335449 AAAGGACTGAGTGGGGCCAGTGG - Intronic
1174945431 20:54980201-54980223 AAAGCTCTGGAAAGGGGCATAGG - Intergenic
1175139093 20:56846580-56846602 AAAGATCTGGGTTTGGCCAAAGG + Intergenic
1175937940 20:62523532-62523554 AGGGCTCTGGGGAGGGCCGGGGG - Intergenic
1176989356 21:15476375-15476397 AAGGCTCTGGGAAGGGAAAGGGG + Intergenic
1181235758 22:21446873-21446895 AAAGCTCTGGGTGTGGGCAGTGG - Exonic
1181355216 22:22292887-22292909 CAAGACCTGGGCAGGGCCAGGGG + Intergenic
1181427477 22:22853345-22853367 AAAGCTCTGGGGATGGAAAGTGG + Intronic
1182248451 22:28979771-28979793 AAAGCTCTGTGTAGGGTGAAAGG + Intronic
1182563313 22:31179098-31179120 AATGGTCAGGGTAGGGACAGAGG + Intronic
1183667867 22:39255655-39255677 AAAGATCTGGGTGGGGCCAGAGG + Intergenic
1184033152 22:41906415-41906437 CAAGCTCAGGGTAGGCCCAGGGG + Exonic
1184300012 22:43553099-43553121 AGAGCTGTGAGTAGAGCCAGGGG + Intronic
949409584 3:3749209-3749231 AAAGCTCTGTGGAGTGTCAGGGG - Intronic
952296401 3:32066349-32066371 AAAGAGCAGGGTAGGGGCAGTGG - Intronic
952927851 3:38334889-38334911 TAAGCCCTGGGTAGGGCTGGAGG + Intergenic
953135867 3:40181269-40181291 AGAGCTGTGGGCAGGGCCATGGG - Intronic
953919991 3:46945062-46945084 TATGCACTGGGTAGGCCCAGAGG - Intronic
954713945 3:52517915-52517937 AAAGCACAGGGGATGGCCAGAGG + Exonic
956883639 3:73536546-73536568 AAATCTTTGGGAAGGGGCAGAGG - Intronic
957765634 3:84621132-84621154 TAAGATCTGGGAGGGGCCAGGGG - Intergenic
957880295 3:86203377-86203399 AAAGCTCTGAGCAAGGACAGAGG + Intergenic
960140911 3:114151150-114151172 AAAGCTCTGAGGAGAGTCAGAGG - Intronic
960405354 3:117252989-117253011 AGAGGTCTGGGTAGGATCAGTGG - Intergenic
961204912 3:125074350-125074372 AAAGCTCTGGGAAGGGAGGGAGG + Intergenic
964079095 3:152729323-152729345 AAAACTGTGGGTCGGGGCAGTGG - Intergenic
964869426 3:161297017-161297039 AATGCTCTGGATGGGGCCTGTGG - Intergenic
964914180 3:161819150-161819172 AAATCACTGGGTAGGGCAATTGG + Intergenic
966445192 3:179994536-179994558 ACACCCCTGGATAGGGCCAGAGG + Intronic
966484075 3:180448295-180448317 AAAGCTTTAGATATGGCCAGCGG - Intergenic
969174169 4:5386101-5386123 AGAGCTGTGGGTGGGGCCTGTGG - Intronic
969188980 4:5501821-5501843 AAAGCTCTGGGAAGTGACCGTGG - Intergenic
969548023 4:7844703-7844725 AAAGCCCTTGGAAGGGCCAATGG + Intronic
969603988 4:8193141-8193163 CGTGCTCTGGGTAGGGCCGGGGG - Intronic
970413344 4:15832827-15832849 AAGGCCCTGGGTTGGTCCAGAGG + Intronic
970598536 4:17622044-17622066 AAGGCACTGGGTAAGGCAAGTGG - Intronic
970772639 4:19633938-19633960 AAAGCACTGAGTAGGGAAAGAGG - Intergenic
970813822 4:20128931-20128953 AAAGCTGAGGGTAGGGCTAAAGG + Intergenic
971024569 4:22575934-22575956 GAAGTTCAGGGTAGGGCGAGGGG + Intergenic
972811588 4:42594030-42594052 AAAGATCTGGATAGATCCAGAGG + Intronic
979388293 4:120096332-120096354 AAAGATCTGGGTGAGGCCTGAGG + Intergenic
980821999 4:138029376-138029398 AACGCTCTGGCAAGGGCCTGAGG - Intergenic
982026736 4:151258953-151258975 TAAGCCCTAGGTAGGGACAGGGG + Intronic
985617660 5:933671-933693 TAAGCTTTGGGAAGGGCCAGGGG - Intergenic
987968340 5:24907260-24907282 AAAGCTCAGGGGAGTGCCAAAGG - Intergenic
990354722 5:54955239-54955261 CAGGCTCTGTGCAGGGCCAGTGG - Intergenic
991586783 5:68210212-68210234 TAAGATTTGGGAAGGGCCAGGGG - Intergenic
996083990 5:119285359-119285381 AAAGCTACTGGTAGAGCCAGAGG + Intronic
996692503 5:126355609-126355631 AAAGACCTGAGCAGGGCCAGAGG + Intergenic
998808206 5:145939230-145939252 AAAGCTGTGGCTTGGGCCATTGG + Intronic
999646516 5:153723025-153723047 AAAACTCTAGGGAGTGCCAGAGG + Intronic
1000096906 5:157979237-157979259 ATCTCTCTGGGTAGGACCAGGGG + Intergenic
1000326277 5:160175055-160175077 AAAGATCTGGCCAGGGACAGTGG - Intergenic
1000847967 5:166304939-166304961 GAACCTCTGGGTGGGGCCATAGG + Intergenic
1001163801 5:169345048-169345070 CTGGCTCTGGGTAGGGACAGAGG + Intergenic
1002405234 5:179025126-179025148 GAAGCTCAGGGAAGGACCAGAGG + Intronic
1002411598 5:179083035-179083057 ACACCCCTGCGTAGGGCCAGTGG - Exonic
1002557741 5:180057188-180057210 AAACCTCTGGGGAGGGGCAAGGG + Intronic
1002585498 5:180244426-180244448 AAAGCGATAGGTAGGGCCAAAGG - Intronic
1003017310 6:2478458-2478480 AGGCCTCTGGGTAGGGCCAGAGG + Intergenic
1003595141 6:7468031-7468053 ATAGGTCTGGGTGGGGCCTGAGG - Intergenic
1003725454 6:8757160-8757182 ACAACTGTGGGTAGAGCCAGTGG + Intergenic
1005386696 6:25292495-25292517 TAATCTCTGGGTAGGGGCTGGGG + Intronic
1006250641 6:32780547-32780569 AAACCTCTGGACAGGGACAGTGG - Intergenic
1007645227 6:43374715-43374737 AAAGCTCTGGCCAGGCGCAGTGG + Intergenic
1009885008 6:69615673-69615695 AAAGGTTTGGGTGGGGCCTGTGG - Intergenic
1011177574 6:84581757-84581779 AAATGTCTGGGGAGGCCCAGTGG - Intergenic
1011833791 6:91404898-91404920 AAGGCTCTGGGTTGGTCCTGGGG - Intergenic
1013648049 6:112164408-112164430 CAAGATCTGGGTATGGCCATAGG + Intronic
1019727321 7:2610340-2610362 TATTCTCTGGGGAGGGCCAGCGG + Exonic
1024229649 7:47354454-47354476 AAAGCCCTGGGGTGGGGCAGGGG + Intronic
1032750463 7:134834873-134834895 AGGGCCCTGGGAAGGGCCAGTGG - Intronic
1034275167 7:149820827-149820849 GAAGGTGTGGGTGGGGCCAGGGG + Intergenic
1035334686 7:158120243-158120265 AGAGCTCTGGGGATGGACAGCGG + Intronic
1037768520 8:21785992-21786014 AAGGCTTTGGGTTAGGCCAGTGG - Intronic
1037770596 8:21796933-21796955 AAAGCTCTTGGGAGGCCCAAGGG - Intronic
1039644608 8:39267084-39267106 AAAGCACTGGGGTGGGCCAGTGG + Intronic
1039838264 8:41275197-41275219 AAAGCTCTGGGTAGGGAAGCAGG - Intronic
1040803349 8:51367829-51367851 AAAACTGTGGATAGGGCCACAGG + Intronic
1041111628 8:54488246-54488268 AAAACACTGGCTAGGGGCAGTGG + Intergenic
1044262782 8:90147215-90147237 AAAGCTCTGGGGATGGGCAAGGG + Intergenic
1045396688 8:101767812-101767834 AAAGCTGTGGGTCAGGCCACAGG - Intronic
1045802942 8:106122925-106122947 CAAGCTCTGTGTGGGGCCTGCGG + Intergenic
1046942408 8:119943772-119943794 AAAGCTATGGGTAGGGTTAAGGG - Intronic
1046954455 8:120048252-120048274 AAAGCTCTGGGTTGGGAAGGAGG + Intronic
1048802419 8:138206496-138206518 AGAGCTGTGGGTAGGTCGAGGGG - Intronic
1049581126 8:143411462-143411484 CAAGCCCTGGGTAGGGCCTGGGG + Intergenic
1049806203 8:144541472-144541494 AAAGTTCTGGAGATGGCCAGTGG - Intronic
1050953986 9:11631706-11631728 AAGGCAGTGGGTAGGGGCAGTGG - Intergenic
1053144833 9:35705390-35705412 GAGGCTCTGGGTAGGGACAGAGG - Intronic
1053178312 9:35945498-35945520 AAAGGTGTGGGCAGTGCCAGTGG - Intergenic
1053313795 9:37035708-37035730 AAATCTCGGGGTAGGGACACGGG - Intergenic
1055308125 9:74951977-74951999 AAAGCACTGGGCTGGGCGAGGGG - Intronic
1055857864 9:80713306-80713328 AAAGCTCTGTCTAGGCTCAGAGG + Intergenic
1056599698 9:88036971-88036993 GAAGCTCTGGGCAGGGGCTGGGG + Intergenic
1056757246 9:89389438-89389460 CATGCTCTGGGTGGGGCAAGTGG + Intronic
1057080692 9:92172444-92172466 AGAGCTCAGGGAAGAGCCAGTGG - Intergenic
1057429689 9:94982064-94982086 AAATCTCTTTGTAAGGCCAGAGG - Intronic
1058048164 9:100379504-100379526 AAAGATCAGGGTGGGGTCAGTGG + Intergenic
1058058355 9:100472014-100472036 AAAACTCTGGCCAGGGGCAGTGG - Intronic
1058334141 9:103804338-103804360 AAAACTCTTGGTAGGACCAAGGG + Intergenic
1058583852 9:106485977-106485999 AGTGCTCTGGGTTGGGGCAGGGG + Intergenic
1059311631 9:113392199-113392221 GTAGCTGTGGGAAGGGCCAGTGG + Intronic
1060115264 9:120935418-120935440 AGAGCTGTGGGTAGGGCCCATGG + Intergenic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1062598504 9:137309779-137309801 GAAGCTCTGGGTCTGGCCATGGG + Intronic
1185609816 X:1387587-1387609 AGAGGTCGGGGCAGGGCCAGAGG + Intronic
1186311455 X:8323712-8323734 CAAGCTCTGTGCAGGGCCCGTGG - Intergenic
1186896189 X:14006689-14006711 AAATCACTGGGAAGTGCCAGTGG - Intergenic
1187963123 X:24585237-24585259 AAAGCTCAGTGCAGGGCCACTGG + Intronic
1188057870 X:25562830-25562852 GAAGCTCTGGGTAAGGTCAGAGG + Intergenic
1188757217 X:33977205-33977227 AAAGCTCTTGGTAGTGAGAGGGG + Intergenic
1189025094 X:37386105-37386127 AAAGCTCTTTGTATTGCCAGAGG + Intronic
1195016232 X:100784401-100784423 ATAACTCTGTGTAGGGCCAAAGG + Intergenic
1195716119 X:107819979-107820001 TGAGATTTGGGTAGGGCCAGGGG + Intergenic
1196990753 X:121326260-121326282 AAGGCTCTGGGAATGGCCTGAGG + Intergenic
1197663181 X:129195535-129195557 ATATCTCTGGGTGGGGCTAGGGG + Intergenic
1197760277 X:130023126-130023148 AGAGCCCTGGGTGGGGGCAGGGG + Intronic
1198927387 X:141814456-141814478 CAGGCCCTGGGTAGGTCCAGAGG + Intergenic
1199909762 X:152272631-152272653 TAAGATTTGGGAAGGGCCAGGGG + Intronic
1200309950 X:155067972-155067994 AAAGCTCTGGGAAGGAAGAGAGG - Intronic