ID: 1074457079

View in Genome Browser
Species Human (GRCh38)
Location 10:113604547-113604569
Sequence TTTCTCCTTTCACCAAACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 1, 2: 7, 3: 33, 4: 330}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074457079_1074457090 29 Left 1074457079 10:113604547-113604569 CCCGGGTTTGGTGAAAGGAGAAA 0: 1
1: 1
2: 7
3: 33
4: 330
Right 1074457090 10:113604599-113604621 CCACCCCTACCTCACTCTGCAGG 0: 1
1: 0
2: 2
3: 35
4: 305
1074457079_1074457086 -10 Left 1074457079 10:113604547-113604569 CCCGGGTTTGGTGAAAGGAGAAA 0: 1
1: 1
2: 7
3: 33
4: 330
Right 1074457086 10:113604560-113604582 AAAGGAGAAAGGCTGGGGGCTGG 0: 1
1: 0
2: 10
3: 105
4: 989
1074457079_1074457091 30 Left 1074457079 10:113604547-113604569 CCCGGGTTTGGTGAAAGGAGAAA 0: 1
1: 1
2: 7
3: 33
4: 330
Right 1074457091 10:113604600-113604622 CACCCCTACCTCACTCTGCAGGG 0: 1
1: 0
2: 0
3: 20
4: 215
1074457079_1074457087 6 Left 1074457079 10:113604547-113604569 CCCGGGTTTGGTGAAAGGAGAAA 0: 1
1: 1
2: 7
3: 33
4: 330
Right 1074457087 10:113604576-113604598 GGGCTGGTTTGCATTCCACAAGG 0: 1
1: 0
2: 2
3: 9
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074457079 Original CRISPR TTTCTCCTTTCACCAAACCC GGG (reversed) Intronic
900388788 1:2424368-2424390 TCTCCCCATTCCCCAAACCCTGG + Intergenic
901840302 1:11950065-11950087 TTTATCTTTTCACCAAGCCTGGG - Intronic
902376033 1:16030291-16030313 CCTCTCCTCTCACCAAGCCCAGG + Intronic
902380972 1:16052036-16052058 CCTCTCCTCTCACCAAGCCCAGG + Intronic
902609190 1:17587400-17587422 TCTCTCCATTGACCAAACCTCGG + Intronic
902687740 1:18089791-18089813 TTACTCCTTGGGCCAAACCCTGG - Intergenic
905174730 1:36128180-36128202 CTTCTCCTTTCAACCAGCCCTGG + Intergenic
907391457 1:54160944-54160966 TTGCTCCTTCCACAAAACCATGG - Intronic
907509608 1:54948363-54948385 TTTCTCCTTTCCAGAAACCAAGG - Intergenic
908322721 1:62993685-62993707 ATTCTCCCTTCCCCAACCCCTGG - Intergenic
909245651 1:73279298-73279320 GTTATCCTTTCCCCAACCCCAGG + Intergenic
909540054 1:76781359-76781381 TCTCTCCTCTCCCCAATCCCCGG + Intergenic
910155014 1:84207087-84207109 TTACTCTTTTCATAAAACCCAGG + Intronic
910241760 1:85094112-85094134 TTCCTCCTTTCACCCTACACTGG + Intronic
910309735 1:85809962-85809984 TATCCCCTTCCACCAAACCCTGG + Intronic
910414065 1:86979362-86979384 TTTCTCCTTCCCCCAGCCCCTGG + Intronic
910467861 1:87519269-87519291 TTTCTCCTTTCCCAAAATGCGGG + Intergenic
910541350 1:88361631-88361653 GTTCCCTTTTCACCAAATCCAGG + Intergenic
910645988 1:89515859-89515881 TCCCTCCTATCTCCAAACCCTGG + Intergenic
910753336 1:90658342-90658364 TTTCACTTTTCAGCATACCCTGG - Intergenic
911718484 1:101163468-101163490 TTTCTCCTTTCACAATAATCTGG - Intergenic
912222002 1:107689164-107689186 TGCCTCCTTTCCCCATACCCAGG + Intronic
914201724 1:145491131-145491153 TTTTTCCCTTCACCATGCCCTGG - Intergenic
914480849 1:148064255-148064277 TTTTTCCCTTCACCATGCCCTGG - Intergenic
914808725 1:151010572-151010594 TTTCTCATTTCTCCAGGCCCTGG - Intronic
915045757 1:153013719-153013741 TTTCTCCTTTCCCCAGGCCCTGG + Intergenic
915538777 1:156554245-156554267 TTTCTCCTTCCACCTCAGCCAGG + Exonic
916052017 1:161042882-161042904 TTTGTCCTTTCACCACAAACAGG - Exonic
916223857 1:162470480-162470502 TCTCTCCTTTCCCCAGCCCCTGG + Intergenic
916478552 1:165193721-165193743 TTTCACCTTTCATCAGACCTTGG - Intergenic
916638808 1:166704050-166704072 TTTCTCCTTTTCCCAAGTCCTGG + Intergenic
917002765 1:170378075-170378097 TTTCCCCTTTCCCCAGCCCCTGG + Intergenic
917231212 1:172840050-172840072 TTTCTCCTCTCTCCAAATCTGGG + Intergenic
917499608 1:175574261-175574283 CTTCTCCTTTCTCCCCACCCTGG + Intronic
917638614 1:176960685-176960707 CTTCTTTTTTCACCAAACCCTGG + Intronic
919514240 1:198501887-198501909 TTTCCCCCTTCCCCAGACCCTGG + Intergenic
920097880 1:203498425-203498447 TTTATACTTTCAGCAGACCCTGG - Intronic
920250811 1:204621127-204621149 TTTCTCCTTTCCCAACAGCCTGG + Exonic
920630038 1:207643565-207643587 TTTCTGGGTTCACCAAACCACGG - Intergenic
920640788 1:207750315-207750337 TTTCTGGGTTCACCAAACCATGG - Intergenic
921288829 1:213635282-213635304 ATTATCCTGTCACCAAAGCCTGG + Intergenic
922467681 1:225855532-225855554 ATTCTCCTTTCCCCACTCCCTGG + Intronic
922825726 1:228516858-228516880 TTTCTACTTTCCACAACCCCTGG + Intergenic
923455837 1:234164454-234164476 TTTCTCCTTCCACATACCCCAGG + Intronic
1062999236 10:1899042-1899064 TTTCTTCTTTCATTAAATCCAGG - Intergenic
1063495026 10:6499076-6499098 TTTCTCCTCACACAAAATCCTGG - Intronic
1064455634 10:15484974-15484996 TCTCCCCTTTCAGAAAACCCAGG - Intergenic
1064973799 10:21092740-21092762 TCTCTACTTTCATCAAACCTGGG + Intronic
1067573583 10:47389423-47389445 TTTCTCCCTCTTCCAAACCCTGG + Intergenic
1068751662 10:60600616-60600638 TTTGTCTTTCCACCAAACCATGG + Intronic
1068936417 10:62639639-62639661 TTCCTCTGTTCACCAAACCTTGG + Intronic
1071256240 10:83874227-83874249 TTTCCCCTTTCCCCAATCTCAGG - Intergenic
1072920655 10:99574290-99574312 TTTCTCCCTTCACCTTTCCCAGG + Intergenic
1073607965 10:104915007-104915029 GTTCACCTGTCCCCAAACCCTGG - Intronic
1073959729 10:108912356-108912378 TTGCTCCTATCTCCAAGCCCCGG - Intergenic
1074411018 10:113228718-113228740 TTTCTCTTTTCACAAAACCCTGG - Intergenic
1074457079 10:113604547-113604569 TTTCTCCTTTCACCAAACCCGGG - Intronic
1078319024 11:10317488-10317510 TTTCTTCTCTCAACAAAACCTGG - Intronic
1080841365 11:35986254-35986276 TCTCTCCTTTAACCAATCCGGGG - Intronic
1081741139 11:45441615-45441637 TTTCTCTTTTCTCAAAACTCAGG - Intergenic
1081905950 11:46670149-46670171 TTTCTCCTTAAAGCAAATCCAGG - Intronic
1081956040 11:47094301-47094323 TTTCTCCCTTCCCCAATCCCTGG - Intronic
1084758759 11:71255025-71255047 TTACTCCTTTCTGCAAAACCTGG - Intergenic
1088580044 11:111306602-111306624 TTTCTGCTTTAACCAGAGCCTGG + Exonic
1090834849 11:130446921-130446943 TTTGACCCTTGACCAAACCCTGG - Intergenic
1091250356 11:134139284-134139306 TTTCTCATTTCAACAAAGACCGG + Intronic
1092107183 12:5930200-5930222 TGGCTCCTTCCATCAAACCCTGG - Intronic
1092122317 12:6053086-6053108 TTTCTCCTTTCCTCAACCACAGG + Intronic
1092144033 12:6202352-6202374 TTCTTTCTTTCACCAATCCCTGG + Intronic
1093266518 12:17009946-17009968 TTGCTACTTTCACCAATACCTGG - Intergenic
1094306230 12:29022682-29022704 TTTCCCCTTCCTCCAACCCCTGG - Intergenic
1095135708 12:38600051-38600073 TTTCTCCCTTCCCCCATCCCTGG - Intergenic
1095418953 12:42005414-42005436 TGTTGCCTTTCACCAAACTCTGG + Intergenic
1096681027 12:53255428-53255450 TTCCTCCTCCCACCAAAACCTGG + Intergenic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1097929457 12:65168411-65168433 TTTCCCATTTCCCCAAACCTTGG - Intergenic
1097980462 12:65732936-65732958 TTTCTCCCTTCTCCAGCCCCTGG + Intergenic
1098370128 12:69749875-69749897 TTTCTTCTTTCCCCAGATCCTGG + Intronic
1098461389 12:70736614-70736636 TATCTCATTTCACCAACCCAAGG - Intronic
1098791387 12:74828577-74828599 TTTCTACCTTAAGCAAACCCTGG - Intergenic
1100051522 12:90454849-90454871 TTTCTCCTTTTCCCAGTCCCTGG + Intergenic
1100702520 12:97163400-97163422 TTTCCCCTTTCACCATACGAGGG + Intergenic
1102212213 12:111135814-111135836 ATTCTCCTTTCCCCAGCCCCTGG - Intronic
1102364363 12:112319155-112319177 CTTCTTCATTCACCCAACCCAGG + Intronic
1104612138 12:130237402-130237424 TGTCTACTTTCACCAACTCCTGG + Intergenic
1106111208 13:26778876-26778898 TTCCTCCTTGCCCCAGACCCTGG + Intergenic
1106712574 13:32353757-32353779 GATTTCCTTTTACCAAACCCTGG - Intronic
1107284162 13:38771320-38771342 TTTCTCTTTTAAACAAGCCCAGG + Intronic
1107582951 13:41811674-41811696 TTTCTCCTTACACAAAGCCAAGG + Intronic
1108396040 13:49992722-49992744 TCTCTCCTTTCTCCAAGCACAGG + Intergenic
1108756039 13:53503410-53503432 TTTCTCCTTCCACCTACCCCGGG + Intergenic
1109988926 13:70028130-70028152 TTTCTTATTTCTCCAAATCCAGG - Intronic
1110244977 13:73312439-73312461 TTTCTCCTTTCTCCAGACCCTGG - Intergenic
1112106170 13:96242167-96242189 TTCCTCCTTTCAACAGCCCCTGG + Intronic
1112419706 13:99236887-99236909 GTTCTCCTTTCTCCACATCCTGG - Intronic
1112599067 13:100837431-100837453 ATTCTCCTTTCCCCAGGCCCTGG + Intergenic
1112756206 13:102636877-102636899 TTTATACTTTCACCAAGCACTGG - Intronic
1113312888 13:109149478-109149500 CATCTCCTTTCTCCAAACCCTGG + Intronic
1113552699 13:111205435-111205457 TTTCTTGTTTTACCAAAGCCAGG + Intronic
1113699504 13:112374263-112374285 TTTCTGCTGTGACCAAGCCCAGG + Intergenic
1113825462 13:113249488-113249510 TTTCTCCATTCACCAAACATTGG + Intronic
1114654309 14:24306960-24306982 TTACTCCTTTCAACAACCCTAGG + Exonic
1116411515 14:44629403-44629425 TTTCTCCTTCCTCCAGTCCCTGG - Intergenic
1116429742 14:44832129-44832151 TCTCTCCTTCCCCCAACCCCTGG + Intergenic
1116688551 14:48074898-48074920 TTACTCTTTTAACCAAACACTGG + Intergenic
1117269815 14:54131689-54131711 TTTCTCCTTTCCCCAAAAAGGGG + Intergenic
1120399974 14:84018550-84018572 ATTTTCATTTCACAAAACCCAGG - Intergenic
1120835349 14:89034195-89034217 TTTCTCTTTTCATCATATCCTGG + Intergenic
1120906430 14:89625109-89625131 TTCCTTCGTTGACCAAACCCGGG + Intergenic
1121878125 14:97473570-97473592 TTTCTCCTTTCCCCCCATCCTGG + Intergenic
1121990899 14:98556244-98556266 TTGCTCCTTCCACCATACCTGGG + Intergenic
1122017030 14:98804974-98804996 TTTCCCCTCTCACCAGCCCCTGG - Intergenic
1122088749 14:99324079-99324101 TTTCTCATTTCACAAAATCAGGG - Intergenic
1124784112 15:32663325-32663347 AGTCTCCTTTCCCCAGACCCTGG + Intronic
1125531737 15:40418101-40418123 TTTCTTCTCTGCCCAAACCCTGG + Intronic
1125716744 15:41823768-41823790 TCTCTCCTGTCACCAAAGGCCGG + Exonic
1127675650 15:61235905-61235927 TCTCTCCCTTCCCCCAACCCTGG + Intergenic
1127757264 15:62104702-62104724 TTTCACCTTTCACCAATGCCTGG - Intergenic
1127863935 15:63016504-63016526 TTTTTCCTTTCTCTAAACCAGGG - Intergenic
1128787914 15:70411941-70411963 TTCTTTCTTTCACCAAAGCCAGG + Intergenic
1129104307 15:73295454-73295476 TCTCTCCAATCCCCAAACCCAGG - Intronic
1131359082 15:91773331-91773353 TTTCCCCTCTCCCCAGACCCTGG - Intergenic
1131779937 15:95845244-95845266 TTTCTCCTGTCACCAAAGACAGG - Intergenic
1131878804 15:96840179-96840201 TTTCTCCCTTCCCCCACCCCAGG - Intergenic
1132781963 16:1632117-1632139 TTTCTCCTTTCTCGGAACCTTGG + Intronic
1133842957 16:9427062-9427084 ATTCTCCTTTCCCCAACTCCTGG + Intergenic
1134464022 16:14457046-14457068 TTTATCCATTCAGCAAACCTTGG - Intronic
1135171723 16:20190044-20190066 TTTCTCTTTTCTCCATACACGGG - Intergenic
1137566681 16:49537774-49537796 TTTCTCTCTTCAACAGACCCAGG + Intronic
1138624462 16:58238010-58238032 TTACTCCTTCCAACAAACCTGGG - Intronic
1140140489 16:72251979-72252001 TTTCTCCTTTCACCAAACAATGG - Intergenic
1140543572 16:75783955-75783977 GTTCTCTTTTCTCCACACCCTGG + Intergenic
1142720943 17:1775403-1775425 TTCGTCCTTACAACAAACCCTGG - Intronic
1143432293 17:6895795-6895817 TTCCTCCTCTCCCCAACCCCAGG - Intronic
1143660524 17:8321947-8321969 CTTCTCCTTGCCCCAAACACTGG + Exonic
1143698719 17:8640865-8640887 TATCTATTTTCAACAAACCCAGG - Intergenic
1146634472 17:34493883-34493905 TTAATCCTCTCACCAACCCCAGG - Intergenic
1147659751 17:42111232-42111254 TACCTCCTTTCGCCAACCCCAGG - Intronic
1149130930 17:53301555-53301577 TTTCTTGTTTCTCCAGACCCTGG - Intergenic
1149568130 17:57653602-57653624 TTTATCTTTTCCCCAACCCCAGG - Intronic
1151287515 17:73123719-73123741 TTCCTCCTTTGACCAAGCCCAGG + Intergenic
1152459553 17:80434063-80434085 GTTCTCCCTTCCCCAGACCCTGG + Intronic
1155002137 18:21697866-21697888 TGTCTCCTTTGACCATACGCTGG + Intronic
1156328305 18:36094582-36094604 TTTCTCCTTTGTTCAAACCCTGG + Intergenic
1156412693 18:36849182-36849204 TTACTCCTCTCACCAGCCCCTGG + Intronic
1156488045 18:37479014-37479036 AGTCTCCATTCACCTAACCCAGG + Intronic
1156498689 18:37543307-37543329 TTCCTCCCTCCTCCAAACCCAGG + Intronic
1156850443 18:41719618-41719640 TTTCTCTTTCCCCCAACCCCTGG - Intergenic
1157019032 18:43756842-43756864 TTTGTCCTTACAGCAATCCCAGG - Intergenic
1159196925 18:65127916-65127938 TTTCTCCTCTCCCCAGACCCTGG + Intergenic
1159706962 18:71702626-71702648 TTCCTCCCTTCCCCAAGCCCTGG - Intergenic
1160002161 18:75035260-75035282 ATTACCCTTTCACCAAACACAGG + Intronic
1160763078 19:795562-795584 ATTCTCGTTTCCCCAAATCCAGG - Intergenic
1162786001 19:13035310-13035332 TTTCCCCTTTCACCTCCCCCTGG + Intronic
1163344619 19:16732569-16732591 TGTCTCCTTGTACCAATCCCTGG + Intronic
1164615809 19:29666117-29666139 TTTCTCGTTTCCCCAACACCTGG + Intronic
1165300518 19:34965469-34965491 TTTCTCCTATTACCAAAAACGGG + Intergenic
1165765758 19:38350015-38350037 TTTCTCTCTTCACCATCCCCTGG + Intronic
1166302741 19:41921631-41921653 TCTCTCCTTCCTCCCAACCCAGG - Intronic
1166568644 19:43780095-43780117 ACTCTCCCTTCACCAAACCTGGG + Intronic
926135576 2:10333376-10333398 TTCCTCCTTTCAGCAAAGTCAGG + Intronic
926456193 2:13071137-13071159 TTTCTCCCTTTAACAAAGCCTGG + Intergenic
926549815 2:14288100-14288122 TCTCTGCTTTCACCACCCCCAGG + Intergenic
927506209 2:23616368-23616390 TTTCTCCTTTCATCTTTCCCTGG - Intronic
927721583 2:25386640-25386662 TTTCACCTTACATAAAACCCAGG - Intronic
929818498 2:45255390-45255412 CTTGACCATTCACCAAACCCTGG - Intergenic
930626432 2:53703350-53703372 TAGCTCCTTTCACCACTCCCAGG - Intronic
931800352 2:65751918-65751940 TTTCTCCTTTCCCCAGTCCCTGG + Intergenic
932809956 2:74816879-74816901 CTTCTCCTTTCTCCATGCCCAGG + Intergenic
933034471 2:77375924-77375946 TTTCCCCTTTCCCTAAATCCTGG + Intronic
933761621 2:85676131-85676153 TTTCTCCTTTCCTGGAACCCAGG - Intergenic
933896170 2:86811480-86811502 GTTCTTCTTTCACTAACCCCTGG + Intergenic
934092592 2:88565835-88565857 TTTTTCCTTTCACCACCCCTTGG + Intronic
935345504 2:102104126-102104148 AGTCTCCCTTCACCACACCCTGG - Intronic
935626201 2:105174180-105174202 TTCCTCCGTTGATCAAACCCTGG - Intergenic
935777394 2:106485995-106486017 TGTCACCTTTCTCCAAATCCTGG - Intergenic
936494968 2:113010874-113010896 TTTCTCCTTCCCCCAGTCCCTGG + Intergenic
936937875 2:117855756-117855778 TTTCTTGTTTCTCCAAAGCCAGG + Intergenic
937030556 2:118735785-118735807 TTCCTCCCTTTTCCAAACCCTGG + Intergenic
937154571 2:119709976-119709998 TTTCCCCTTTCCCCAGTCCCCGG - Intergenic
937396165 2:121536772-121536794 TTTCTCCCTTCCACAATCCCTGG - Intronic
937451002 2:122001934-122001956 TTACTCCTTTCACAAAGTCCTGG + Intergenic
937754914 2:125525465-125525487 TTTCTCCTTCCCTCAATCCCTGG - Intergenic
939114711 2:138047222-138047244 TTTCTCATTTCAACAAACTAGGG - Intergenic
940020556 2:149152195-149152217 TATCCCCTATCACCAAACGCAGG + Intronic
940568086 2:155394605-155394627 TTTCTCCTTTCAGCAAATCTGGG + Intergenic
941813417 2:169776879-169776901 TCTCTCCATTCCCCAAACCTAGG + Intronic
941837549 2:170042126-170042148 TTTCTCCTTCTCCCAACCCCTGG + Intronic
942652411 2:178182442-178182464 TTTCTCCCTTCTCCAAATACAGG - Intergenic
943089187 2:183353697-183353719 TTTCTCCTTGCAACACACTCTGG - Intergenic
943184101 2:184583659-184583681 TCTCTCCTTACCCCAGACCCTGG - Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
944277252 2:197853022-197853044 TTTCTCCTTTCTCCACTCCCTGG + Intronic
944563512 2:200964397-200964419 CTTCTCCCTACCCCAAACCCTGG - Intergenic
944820805 2:203428857-203428879 TTTCCCCTTTCACCTAGCACAGG - Exonic
946826801 2:223687635-223687657 TATCTCCTTTAACCTAACTCTGG - Intergenic
948150738 2:235742699-235742721 TTTCTCCTATCACCAGCCACAGG - Intronic
948337849 2:237224473-237224495 TTTCTGCTTTCACCAAACCCAGG + Intergenic
948600479 2:239105187-239105209 TTGCTCCTTACAGCAAACACAGG + Intronic
1168975779 20:1964820-1964842 TGTCTCCTTTGACCAAACCCCGG - Intergenic
1169878489 20:10322786-10322808 TTTCTCCTTTCACCACCTCCAGG - Intergenic
1170498004 20:16945619-16945641 TTTCTCCATTCACCAGACACTGG + Intergenic
1170844146 20:19947960-19947982 TATCTCAGTTCCCCAAACCCTGG - Intronic
1171849066 20:30295332-30295354 TATCTCCATTCTTCAAACCCAGG + Intergenic
1173689831 20:44952055-44952077 TTTCTCCTTTCACACACCCATGG + Intronic
1176952921 21:15066031-15066053 TTTCTCGTTTCACCAATCTGTGG - Intergenic
1177082082 21:16652247-16652269 TTTTTCCTTTATCCAAACTCAGG - Intergenic
1177253315 21:18625266-18625288 TTTATCCTTTCATCAATCTCAGG + Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1178617103 21:34144146-34144168 TTACTCCTTTCAGCAGCCCCAGG + Intergenic
1178785077 21:35646132-35646154 TTTCCCCTTTCTCTAAGCCCTGG - Intronic
1181370421 22:22410616-22410638 ATTCTCCTTTCCCCAATTCCAGG + Intergenic
1181729739 22:24836107-24836129 TTTCTCCTCTCCCCAGCCCCTGG + Intronic
1183215702 22:36478441-36478463 TTCCACCTTTCACAAACCCCTGG + Intronic
1183361136 22:37384128-37384150 TCTCTCCTTCCACCAAGGCCTGG - Intronic
949472335 3:4409383-4409405 TTTTTCTTTTCACCAATCCCAGG - Intronic
949768252 3:7550621-7550643 TTTCTCCTTCCACCACACTGAGG + Intronic
950815141 3:15693085-15693107 TTTCTCCTTTCCCCAGTCCCTGG - Intronic
955752860 3:62200081-62200103 TTTCTTCCTTCCCCCAACCCTGG - Intronic
955778662 3:62461067-62461089 ATTCTTCCTTCACTAAACCCTGG - Intronic
955928599 3:64032605-64032627 ATTCTCCTTTCCCCAGCCCCTGG - Intergenic
956731795 3:72203519-72203541 TTCCTCCTATCACTAATCCCTGG - Intergenic
957519053 3:81295375-81295397 TGTCTCATTTCACCCAAGCCTGG - Intergenic
958013400 3:87910217-87910239 TTTCTCCTTTCATACAACACAGG - Intergenic
958650735 3:96932593-96932615 GTCCTCCTGTAACCAAACCCAGG + Intronic
959521280 3:107325764-107325786 TTTCCCTTCCCACCAAACCCTGG + Intergenic
959551176 3:107659798-107659820 TTTCTAGTCTCACTAAACCCAGG - Intronic
960992788 3:123322678-123322700 GAGCTCCTCTCACCAAACCCAGG - Intronic
961610055 3:128129846-128129868 TTTTTCCTTTCCCCAGCCCCTGG - Intronic
962890246 3:139665468-139665490 TGTCTCCTTTCATCAGACCATGG - Intronic
963572018 3:147009292-147009314 TTTCTCCATTCAGCAGTCCCTGG + Intergenic
964295644 3:155230313-155230335 TGTCTCCTTCCACCAAAACAGGG + Intergenic
965740326 3:171867366-171867388 TTTCTTCTTTCAACCATCCCCGG + Intronic
966226150 3:177600054-177600076 TTACTCCCTTCCCCAAACCAGGG - Intergenic
966242422 3:177769320-177769342 TTTGGCCTTCCACAAAACCCTGG + Intergenic
967415647 3:189215274-189215296 TTTCTCCTTTCCACACAGCCGGG + Exonic
967756228 3:193172616-193172638 TTTCCCCTCTCTCCAGACCCTGG - Intergenic
968703004 4:2065507-2065529 CTTCTCCTGCCACCAAAGCCAGG - Exonic
969546017 4:7828417-7828439 TTTCTTCTTTCAGCAGACACAGG + Intronic
970338433 4:15078797-15078819 TTTCCACTTTCCCCAAACTCTGG - Intergenic
970340202 4:15098196-15098218 TTTCCCCTTTCCCCAAACCCTGG - Intergenic
970718615 4:18958933-18958955 TTTCTCCTTTCATCAAAATGGGG - Intergenic
970922850 4:21415285-21415307 TTTCTCCTTCCTCCAGCCCCTGG - Intronic
970950254 4:21747278-21747300 GTTCCCCTTTCAGGAAACCCTGG + Intronic
971094051 4:23377933-23377955 TTTGTGCTTTCCCCAAACCCTGG - Intergenic
971735997 4:30452908-30452930 TTTCTCCTTTGAATAAACTCTGG + Intergenic
972320562 4:37969905-37969927 TTTCTCCTCTCTCCAGCCCCCGG + Intronic
972699586 4:41481344-41481366 GTTCTCCTTTCACCCAGCCCAGG - Intronic
974821229 4:67068690-67068712 TCTCTCCTATCCCCAATCCCTGG - Intergenic
975356886 4:73417241-73417263 TTTCTTCTTTCAATAAAACCTGG - Intronic
975477746 4:74842919-74842941 TCTCTCCTTTCTTTAAACCCAGG - Intergenic
976059848 4:81114310-81114332 TTTTTTTTTTCACCAAACACAGG - Intronic
977127569 4:93188800-93188822 TTTCACCTTCCACGAAACCCTGG + Intronic
977172070 4:93775404-93775426 CTTCTCCTCTCACCAAGCCTAGG + Intergenic
977338001 4:95721995-95722017 TTTCCCCTTTCAGCTAACCAGGG - Intergenic
977437212 4:97013631-97013653 TTTCTCCATTCACCAAATGCAGG + Intergenic
979266628 4:118710877-118710899 TCTCTTCTTTCACCCACCCCTGG - Exonic
981121544 4:141056875-141056897 TTTCTTCTTTCCTCAAGCCCTGG - Intronic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
982365840 4:154577421-154577443 TATCTCCTTTCAACAAACAAAGG - Intergenic
982520595 4:156411893-156411915 TTTATCCTTTCAAAAATCCCAGG - Intergenic
983063048 4:163179493-163179515 TTTATCTTCTCAGCAAACCCAGG + Intergenic
985009450 4:185567694-185567716 TTTCTTTTTTCCCCAAACCAAGG + Intergenic
985624592 5:978513-978535 GTTCCCCTTTCTCCACACCCCGG + Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
988707134 5:33737409-33737431 TTTCCCCTTTCCCCAGCCCCTGG - Intronic
988840042 5:35074571-35074593 TTTCTCCCTTCCTCAAGCCCTGG - Intronic
990031122 5:51261005-51261027 TTTTCCCTTTCACCAGCCCCTGG + Intergenic
990425575 5:55685264-55685286 TTTCCCCTTTCCCCAGCCCCTGG + Intronic
991098696 5:62767710-62767732 CTTCTCCTTTAACAAAGCCCAGG + Intergenic
994456427 5:100013702-100013724 TTTCTTCTTTCAAGTAACCCTGG + Intergenic
994793988 5:104269571-104269593 TTTCTTGTTCCCCCAAACCCTGG - Intergenic
995240615 5:109882103-109882125 TTTCCCCTCTCAACAAAGCCTGG - Intergenic
995489163 5:112671966-112671988 TTCCTCCTTCCCCCAACCCCTGG + Intergenic
997470069 5:134112830-134112852 TTTCTCCTTTCTCCAAGGACTGG + Intergenic
997844585 5:137275388-137275410 CTTATCCTCTCACCAAACACAGG + Intronic
998679869 5:144455146-144455168 TTTCTCCTTTCCCCCAACAGAGG + Intronic
1000198143 5:158980169-158980191 TTTGTCCTCTCTCCAAACCTGGG + Intronic
1000382488 5:160641600-160641622 GTTCTCCTTTCACCAACCCCTGG + Intronic
1001268228 5:170290684-170290706 TGTCTTCTTTCACCATCCCCTGG + Intronic
1001484978 5:172113184-172113206 ATTCTCTTTTCACCACATCCTGG - Intronic
1001513011 5:172336871-172336893 TTTCTCCCTTGAAGAAACCCAGG - Exonic
1001801035 5:174544322-174544344 TTTCTCCTTATACAACACCCAGG + Intergenic
1003109365 6:3240745-3240767 TTCCTCCTTTCCCCCAACACTGG + Intronic
1004615918 6:17288762-17288784 TTCCACCTTTCCTCAAACCCAGG - Intronic
1007709203 6:43811181-43811203 TTTGCCCATTCACCAAACACAGG - Intergenic
1009455124 6:63847905-63847927 TTTCTCCTTTTACCAAATGATGG - Intronic
1010545676 6:77152257-77152279 TGTCTCCTTTTACCATAGCCTGG - Intergenic
1011498408 6:87961608-87961630 TTTCTCCTGTGACCAAGCCTAGG + Intergenic
1011640990 6:89415676-89415698 TTTCTACTTGCTCCAAACCTTGG + Intergenic
1012378134 6:98587054-98587076 CTCCTCCTTTCCCCAAAACCTGG - Intergenic
1012394677 6:98782669-98782691 TCTTTCCTTTCACAAAACTCGGG + Intergenic
1012485411 6:99716016-99716038 ATTCTCCTTTCTCCACATCCTGG + Intergenic
1013918908 6:115376269-115376291 TTTTACCTTTTACCAAACTCTGG + Intergenic
1018061396 6:160092512-160092534 TTTCTTCATTCACCAGCCCCAGG + Intronic
1019654462 7:2182788-2182810 GTTCTCCTTTCCCCAGCCCCTGG - Intronic
1021311655 7:19105227-19105249 TTTCTCCTTACACAAAATACAGG + Intronic
1022448392 7:30490081-30490103 TTTCTCCTTTCCCCAGACCCTGG - Intergenic
1023847869 7:44133037-44133059 TTTTTCCTTTAGGCAAACCCAGG - Intergenic
1026557018 7:71417397-71417419 TTTTTGCTGTCATCAAACCCTGG + Intronic
1026836487 7:73643074-73643096 TTTCCCCTTGCACCACAGCCAGG + Intergenic
1027185096 7:75966346-75966368 TTTCTGTTTTCACCAAAGACTGG + Intronic
1027941237 7:84683015-84683037 ATTCCCATTTCACCAAATCCCGG + Intergenic
1027994831 7:85412578-85412600 TTTGTCCTTTCACTAAAAACAGG + Intergenic
1028737249 7:94230521-94230543 TTTCACCTTTCTGCTAACCCAGG + Intergenic
1028969302 7:96839645-96839667 TTTCTCCTTTCCCCAAATTGTGG + Intergenic
1029656165 7:101926135-101926157 TTTCTCATTTTGCCAAATCCTGG - Intronic
1029855511 7:103512162-103512184 TTTCCCCTTTCTCCAGATCCTGG + Intronic
1032062195 7:128734366-128734388 TTTCTACTTGCTCAAAACCCTGG + Intergenic
1032555063 7:132824270-132824292 TTTTTTCTTTCACCTATCCCTGG - Intronic
1032733923 7:134672587-134672609 TTTCCCTTTTCAGCCAACCCTGG + Intronic
1032938051 7:136756867-136756889 TTTTTCCTTTCTCCCATCCCAGG + Intergenic
1033855663 7:145558229-145558251 TCTCTCCTTTCACCACACAGAGG + Intergenic
1034301474 7:150019260-150019282 TTAATTCTTTCACAAAACCCTGG - Intergenic
1034804572 7:154077998-154078020 TTATTTCTTTCACAAAACCCTGG + Intronic
1034929116 7:155146751-155146773 TTTCCCATTTCACAAAACCAAGG - Intergenic
1036006099 8:4665174-4665196 TTTGTCCATTTGCCAAACCCTGG + Intronic
1036054160 8:5231614-5231636 TTTCTCCTTCAGCCAAACCCAGG + Intergenic
1036069444 8:5424482-5424504 ATTCTCCTTTCTCCAAGGCCAGG + Intergenic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1036438349 8:8757252-8757274 TTTCTCCTTTTGCCAGTCCCTGG + Intergenic
1039756778 8:40531681-40531703 TTTCTCCGTTCTCCAAGCACAGG - Exonic
1039835314 8:41251421-41251443 TTTCTCCTTACCCCAGCCCCTGG + Intergenic
1039991029 8:42487902-42487924 TCTCGCCTTTCTCCAACCCCTGG + Intronic
1041427930 8:57743710-57743732 TTACTGCTCTCAGCAAACCCAGG - Intergenic
1042912583 8:73843160-73843182 ATTCTCCTTTCCCCAGCCCCTGG - Intronic
1043485980 8:80699896-80699918 TCTCCCCTTTTACCATACCCAGG + Intronic
1046119049 8:109821841-109821863 TTGATCCTTTCAAAAAACCCAGG - Intergenic
1048963266 8:139597242-139597264 TTTCTCTTTACCCCGAACCCAGG + Intergenic
1049701358 8:144014747-144014769 TTTCTCATTCCAGCAATCCCTGG - Intronic
1052915007 9:33918397-33918419 TTTCTCCTTTCAACATACTTAGG + Exonic
1053786788 9:41658052-41658074 TATCTCCATTCTTCAAACCCAGG + Intergenic
1054158273 9:61656143-61656165 TATCTCCATTCTTCAAACCCAGG - Intergenic
1054478046 9:65587148-65587170 TATCTCCATTCTTCAAACCCAGG - Intergenic
1054714002 9:68539451-68539473 TCTCTCCTTCCACCAGCCCCTGG + Intronic
1054775946 9:69123436-69123458 TTTCTCCTTTCCCCAGCCTCTGG + Intronic
1054814852 9:69465290-69465312 TTTGTGCTTCCACCAAACCTGGG + Intronic
1054923325 9:70563483-70563505 CTTCTCCTTTCACCCAATTCAGG + Intronic
1055636644 9:78285491-78285513 ATTCTCCTTTCTCCAGCCCCTGG - Intergenic
1056224322 9:84480611-84480633 TTCCTCTTTTCACCAAGCCTGGG - Intergenic
1057358311 9:94350279-94350301 TTTCTCCTTTCCCCAGCTCCTGG + Intergenic
1057385941 9:94606065-94606087 TCTCTCCTTTCACCTTATCCTGG - Intronic
1057649438 9:96907331-96907353 TTTCTCCTTTCCCCAGCTCCTGG - Intronic
1058681182 9:107441579-107441601 TTTCCCCTTCCACCAGCCCCTGG - Intergenic
1058749276 9:108023283-108023305 TTCCTCTTTTTACCAAGCCCTGG + Intergenic
1059489504 9:114655573-114655595 CTTCACCTCCCACCAAACCCTGG + Intergenic
1060862030 9:126962384-126962406 GGTCTCCTTTCAGCTAACCCAGG + Intronic
1061405107 9:130389400-130389422 TTTCTTCTTCCCCCAGACCCAGG + Intronic
1062338270 9:136082044-136082066 TTTCTCCTTTCACAAAATGGGGG + Intronic
1062526553 9:136980198-136980220 TTTCTCCTTTAACTCAGCCCTGG - Exonic
1185977854 X:4741250-4741272 TTTCTCCCTTCCCCAGCCCCTGG - Intergenic
1186159557 X:6762513-6762535 TTTCTCTTTTCTCCACTCCCTGG - Intergenic
1186923206 X:14304363-14304385 TTTCTCCTTTCTTCAAACCAGGG + Intergenic
1188219392 X:27522606-27522628 TTTCCCCTGTTACCAGACCCTGG + Intergenic
1188572630 X:31606668-31606690 TTTATTTTTTCACCAAACCAAGG + Intronic
1190212066 X:48456877-48456899 TTGCTCCTTTCAGCCAACCTAGG + Intergenic
1190283499 X:48946827-48946849 TTTCCCCTCTCTCCAAAGCCAGG - Intronic
1190421847 X:50292865-50292887 TGTCTCCTTTGTCCAAGCCCTGG + Intronic
1193146530 X:78082060-78082082 TTCCTCCTTCCCCCAACCCCCGG + Intronic
1193240567 X:79164355-79164377 TTTCTGCTTCCACCAAAACCAGG + Intergenic
1193512637 X:82423678-82423700 TTTCTCCTTTCCTCAACCACTGG - Intergenic
1194499445 X:94661766-94661788 TTTCTGGTTTCAGAAAACCCAGG + Intergenic
1195858468 X:109355881-109355903 TTTCTCCTTTCCCTGAACCTTGG - Intergenic
1197050188 X:122047746-122047768 TTTCTCCATTCACAAAATTCTGG + Intergenic
1198241292 X:134789236-134789258 TTTCTCTGTTCACCATATCCAGG + Exonic
1198478205 X:137016343-137016365 TCTGTGCTTTCACAAAACCCTGG - Intergenic
1198862981 X:141090425-141090447 TTTTTCCTTCCAGCAGACCCTGG - Intergenic
1198899711 X:141496962-141496984 TTTTTCCTTCCAGCAGACCCTGG + Intergenic
1199428634 X:147733316-147733338 TTTCTCCTTCCGCCACCCCCAGG + Intergenic
1200865427 Y:8038360-8038382 TCTCTCCTTTTACCCAAACCTGG + Intergenic
1202112863 Y:21442719-21442741 TTTCTCCTGTTGCCAAACCATGG + Intergenic