ID: 1074459452

View in Genome Browser
Species Human (GRCh38)
Location 10:113624137-113624159
Sequence ATTCACATGCAGAAAGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 419}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074459452 Original CRISPR ATTCACATGCAGAAAGGGAA AGG (reversed) Intronic
901277859 1:8006745-8006767 ATTCACATGCCGAGAGGAAAAGG + Intronic
901496935 1:9627695-9627717 AGTCTCCTGCACAAAGGGAAGGG + Intergenic
902069555 1:13722696-13722718 ATTCTAATACAGAATGGGAATGG - Intronic
902155619 1:14483258-14483280 ATTCAAATGAAGATAGAGAATGG + Intergenic
902279249 1:15362401-15362423 ATCCACTTACAGACAGGGAAAGG - Intronic
902767724 1:18628429-18628451 TTTCACATCCAGCAGGGGAAAGG - Intergenic
903095213 1:20965647-20965669 ATTCACAAAATGAAAGGGAAAGG - Intronic
904556359 1:31367442-31367464 GTTCACCTGCAGAAATGGGACGG - Exonic
905263497 1:36735382-36735404 ATTCACAAATAGAAAGGAAAGGG - Intergenic
906636895 1:47416105-47416127 ATCCAAAGGCAGAAAGGGAGGGG + Exonic
906784309 1:48600955-48600977 ATAGACGTGGAGAAAGGGAATGG - Intronic
907058522 1:51396588-51396610 CATCACAAGGAGAAAGGGAAAGG + Intronic
907509489 1:54947580-54947602 ATTGAGATGCAGAGAGGGGAAGG + Intergenic
908023604 1:59924720-59924742 ATTCACAGGAAGATAGGAAAAGG + Intronic
908364828 1:63410230-63410252 ATTCACAGCCATAAAGAGAATGG - Intronic
908786276 1:67737532-67737554 TTACTGATGCAGAAAGGGAAAGG - Intronic
909297440 1:73968573-73968595 CTTCACTTGGAGAGAGGGAAAGG + Intergenic
909461787 1:75924542-75924564 ATACACATATAGAAAGAGAAAGG + Intronic
909589901 1:77335939-77335961 ACTCACATGGTGAAAGGGACAGG + Intronic
909855540 1:80525334-80525356 AATCATATTCACAAAGGGAATGG - Intergenic
909894418 1:81048598-81048620 CTACTCATACAGAAAGGGAAAGG + Intergenic
910118273 1:83756619-83756641 AACAACATGAAGAAAGGGAAGGG + Intergenic
910662483 1:89688656-89688678 ATTCTTCTGCAGAAAAGGAAGGG - Intronic
911255744 1:95631194-95631216 ATTTACATTCAGAAAGGAAAAGG - Intergenic
911499743 1:98670424-98670446 ATGCAGCTGCAGAAAGGGACAGG + Intronic
911822226 1:102436812-102436834 ATTCCCATGCAGAAATGGAGTGG + Intergenic
912184827 1:107262775-107262797 ATTCACCTCCAGAAAGGGGTTGG + Intronic
912374038 1:109195771-109195793 ATTCAAAGGCAGAAATGCAAAGG + Intronic
914735136 1:150409164-150409186 ATTATTATGCAGAAGGGGAAAGG - Intronic
915277214 1:154797535-154797557 ATTCAGATGCAGACAAAGAACGG - Intronic
915448927 1:155991010-155991032 ATTCAACTGCAGAAAGGCAGAGG + Intronic
915639348 1:157211038-157211060 TTGCAAATGCAGAAAGGGAGAGG + Intergenic
915736219 1:158087229-158087251 TTTCACATTTAGAAAGGCAATGG - Intronic
916878128 1:168992246-168992268 ATTCACATGAAAAAAGCTAAAGG - Intergenic
916960695 1:169885650-169885672 AATAAAATGCAGAAAGAGAAAGG + Intronic
918009202 1:180570951-180570973 ATTCCCATTCAGAAAGTGAAAGG + Intergenic
918117647 1:181510658-181510680 ACTCACAGGCAGGAAGGGAATGG - Intronic
918221702 1:182441420-182441442 ATCCACATACAGAAAGGAAATGG - Intergenic
919163266 1:193859484-193859506 AGTCACAAGTAGAAAGGGACTGG + Intergenic
919537372 1:198804991-198805013 ATTCACATACAGAAAGACATGGG - Intergenic
921260817 1:213383759-213383781 ATGCACACGCACACAGGGAAAGG + Intergenic
921399120 1:214700941-214700963 ATAGACAAGCAGAGAGGGAATGG + Intergenic
922534726 1:226371335-226371357 CTGGACATGCAGAAATGGAAAGG - Intronic
923551986 1:234971258-234971280 ATTCACAGCCACAAAGGGAGTGG - Intergenic
924082712 1:240416037-240416059 TTTCACATACAGAAAGAGGAAGG - Intronic
924675742 1:246176020-246176042 ATTCAAAAGCAGAAAGATAATGG + Intronic
1064846479 10:19660567-19660589 TTTCACATGGAGAAAGGTGAAGG - Intronic
1064887889 10:20132696-20132718 ACTCATATGCTGAAAGTGAAAGG - Intronic
1065935729 10:30518906-30518928 ATCTACAAGCAGAAAGGCAAGGG + Intergenic
1066572087 10:36784486-36784508 AATCAGCTGCAGAAAGTGAATGG + Intergenic
1068976001 10:63010237-63010259 ATTCTGATACAGAAATGGAAGGG - Intergenic
1069792710 10:71033517-71033539 ATCCACATGCAGAAAGGTCACGG - Intergenic
1070215478 10:74375126-74375148 ATTTATATGCAGAAAGTGTAAGG - Intronic
1071035833 10:81244102-81244124 TCTCACATGCAGAAAGGTCAAGG - Intergenic
1071264219 10:83949856-83949878 ACTCACAGGCAGAAGGTGAAGGG - Intergenic
1071396594 10:85229686-85229708 ATCCACATGCAGAGAGGCCATGG + Intergenic
1071539997 10:86473083-86473105 TTTCATAAGCAGAAAGGGACAGG + Intronic
1072056778 10:91766176-91766198 ATTTACATGAGGAAAAGGAAAGG - Intergenic
1072403078 10:95125402-95125424 ACTCCCCTGCAGAAATGGAATGG - Intergenic
1073493137 10:103868354-103868376 ATTCACTTACAGAAACTGAAAGG - Intergenic
1074459452 10:113624137-113624159 ATTCACATGCAGAAAGGGAAAGG - Intronic
1074655023 10:115575574-115575596 ATTAGCATGCAGAAAGAAAAAGG - Intronic
1075306234 10:121370171-121370193 ATTCAATTGCAGAAATGGCATGG + Intergenic
1075463523 10:122634199-122634221 ACTCACATGAAGAAAGGAATGGG - Intronic
1076107707 10:127836450-127836472 ACTCACATGCAGAATGGAAATGG + Intergenic
1076143892 10:128101394-128101416 ATGCAGAATCAGAAAGGGAAAGG - Exonic
1076413779 10:130270714-130270736 CTTAAGATGCAGGAAGGGAAAGG + Intergenic
1076642188 10:131926088-131926110 ATACACAGGCAAACAGGGAAAGG - Intronic
1077750141 11:4958188-4958210 ATTGAAATGCAGAAGAGGAAGGG - Intronic
1077755408 11:5023725-5023747 TTTCACATAGAGAAATGGAAGGG + Intergenic
1078272286 11:9807329-9807351 ATTCAAATGCAGTGAGGGTAGGG - Intronic
1078399114 11:11008741-11008763 ATTAAAATGCAGCAAGGTAAGGG + Intergenic
1078475798 11:11628858-11628880 ATTAAAATGCAAAAAGGGAGAGG + Intergenic
1079757940 11:24289201-24289223 AGTCACCTGTAGAAAGGGACTGG + Intergenic
1079796437 11:24809286-24809308 ATTCACATGTGGAGTGGGAAGGG + Intronic
1079917844 11:26393040-26393062 GTTAATATGCAGAAAGGCAAAGG + Intronic
1080172620 11:29323947-29323969 AATCACATAAAGAAATGGAAGGG - Intergenic
1080876404 11:36278898-36278920 ATTCTCATGCAGAAGGAAAAGGG - Intronic
1084629213 11:70334908-70334930 AATGACAGGCAGAAAGGGACAGG - Intronic
1085430325 11:76442574-76442596 AGTCACAGGCAGCATGGGAAAGG + Intergenic
1086829130 11:91537531-91537553 ATTCTCATGCTGAAGGGGAGGGG + Intergenic
1087218458 11:95520044-95520066 GTCCACATGCAGCAAGGAAAGGG - Intergenic
1087303799 11:96465644-96465666 ATTCTCATGGCAAAAGGGAAAGG - Intronic
1087424040 11:97967321-97967343 ATTCCCGTGCAGAAAGAGAATGG - Intergenic
1087773140 11:102232565-102232587 ATTCAAACTCAAAAAGGGAAAGG - Exonic
1088121704 11:106377788-106377810 AATCAAATGCAGATAGTGAAGGG + Intergenic
1088420748 11:109643337-109643359 TTTCACTAGCAGCAAGGGAATGG - Intergenic
1089324437 11:117647644-117647666 AGACAAATGGAGAAAGGGAAGGG + Intronic
1089351517 11:117824129-117824151 AGCCAGATGCAGAAAGGGGAGGG - Intronic
1089576830 11:119450495-119450517 ATTCTCTTGAAGAAAGGAAAGGG + Intergenic
1090452630 11:126820138-126820160 ATTCACATGAACAAAATGAATGG - Intronic
1091252960 11:134159289-134159311 GTTAAAATGGAGAAAGGGAATGG - Intronic
1091432536 12:448685-448707 ATTCACAGACTGAAAGGGAAAGG + Intergenic
1091509754 12:1110243-1110265 ATTCAGATGCTGAAATCGAATGG + Exonic
1092105170 12:5916308-5916330 ATGTACATGCAGAACGTGAATGG + Intronic
1092212634 12:6657579-6657601 ATAGCCATGCAGAAATGGAAAGG - Intronic
1096177944 12:49535359-49535381 ACCCACATGCACAAAGGGCAGGG - Intergenic
1096943871 12:55382220-55382242 ATTAAGATTCAGAAAGGAAAAGG + Intergenic
1097291317 12:57918089-57918111 AAGCAAATGCAGATAGGGAAGGG + Intergenic
1097670499 12:62531414-62531436 ATTCACATGCAGAAGAGTGATGG - Intronic
1098142061 12:67459891-67459913 ATACATATGCAGAAAAGGGAAGG - Intergenic
1098838372 12:75448673-75448695 ATTCTCATGCAGCCAGGGAGTGG - Intergenic
1099133950 12:78870065-78870087 ATTTCCATGTAGAACGGGAATGG + Intronic
1099192994 12:79580005-79580027 GATCACATGCAGATAGAGAATGG + Intronic
1099554431 12:84092614-84092636 ATTCATAGGCAGACAGGGACAGG - Intergenic
1100140280 12:91610248-91610270 ATTCTCATTCATAAAGTGAAGGG - Intergenic
1100547405 12:95616265-95616287 ATTCACAGTCAGAACTGGAAGGG + Intergenic
1101282240 12:103270277-103270299 GTTTACAGGCACAAAGGGAATGG + Intronic
1101426375 12:104591903-104591925 AATCACATGCAAAAAGAGAAAGG + Intronic
1102631609 12:114285765-114285787 ATACACGTGCAGGAGGGGAATGG - Intergenic
1103484701 12:121274580-121274602 AGCCACCTGCAGAAAGAGAAAGG + Exonic
1103870883 12:124090728-124090750 ATTCAGCTGCAGAAAGTGAATGG + Intronic
1104526872 12:129532321-129532343 ATAAACATGCAGTAAGGCAATGG + Intronic
1106629266 13:31453377-31453399 ATTCACATATAAAAAGGTAAAGG + Intergenic
1107045585 13:35988837-35988859 ATTCATTTGCAGTAAGGAAATGG + Intronic
1108761396 13:53570165-53570187 ATGGATATGCAGAAAGGGGAAGG - Intergenic
1108829974 13:54465180-54465202 AGCCACATGCAGAAAAGTAAGGG + Intergenic
1109202605 13:59447803-59447825 GTTCACATTCAGACAAGGAAAGG - Intergenic
1109339376 13:61035731-61035753 ATTGGCTTGCAGAAATGGAATGG - Intergenic
1110004942 13:70254961-70254983 ATTCCCAGGCAGAAAGGGGCAGG + Intergenic
1110541566 13:76712310-76712332 ATTTACCTTCAGAAAGGTAAAGG + Intergenic
1111633911 13:90878920-90878942 GTTTAAATGCACAAAGGGAAAGG + Intergenic
1115793449 14:36905881-36905903 ATACAAATGGAAAAAGGGAAGGG + Intronic
1116079451 14:40154649-40154671 ATTTGCTTGCAGAAAGGGAAGGG + Intergenic
1116384650 14:44315635-44315657 ATTCTAATGCACAAAGAGAAAGG + Intergenic
1116521294 14:45850513-45850535 AGTAAGATTCAGAAAGGGAAAGG - Intergenic
1116633327 14:47360868-47360890 AATCAGATACAGAAAGGAAAAGG + Intronic
1117715247 14:58573647-58573669 ATTCTCAGGTAGAAGGGGAAAGG - Intergenic
1118626963 14:67668424-67668446 ATTCAAAGGCAGAAAGTGAATGG + Intronic
1120442724 14:84560148-84560170 ATTCTCCTGCAGAAACAGAATGG - Intergenic
1122064272 14:99160506-99160528 AATCACAAGTAGAAAGGGAAAGG + Intergenic
1123431910 15:20225184-20225206 TTTCCCTTGAAGAAAGGGAATGG - Intergenic
1123917757 15:25049360-25049382 TTTCACATGCAGGATGGGCATGG - Intergenic
1124650908 15:31473260-31473282 ATCCACAGGCAGATAGGGCAGGG - Intergenic
1124689135 15:31807185-31807207 TTTCACCTGCAAAATGGGAACGG - Intronic
1126318241 15:47393721-47393743 ATTCTCATGCAGAAGGGAAAAGG + Intronic
1126775316 15:52095175-52095197 ATTCTCAAGGAGAAAGGGAAAGG - Intergenic
1127109897 15:55657384-55657406 ATTCAGATGGAGAAAGGTGAAGG + Intronic
1128137080 15:65271783-65271805 ATTCTCACACAGAAAGGAAAAGG - Intronic
1128727074 15:69996119-69996141 ATTCACCTACAGAAAGAGCAGGG - Intergenic
1128831160 15:70770125-70770147 ATTTCCTTCCAGAAAGGGAAGGG - Intergenic
1129168400 15:73792775-73792797 ATTCAGATGCAGAAGAGGACAGG - Intergenic
1129707693 15:77804161-77804183 ATTCACATGCAGGAGGGGCTGGG + Intronic
1129900852 15:79148455-79148477 CTTCACATGGAGGAAGGGTAAGG + Intergenic
1130186719 15:81690442-81690464 ATTCTCTTGCACAAATGGAAGGG - Intergenic
1130714065 15:86314401-86314423 ATTCACATTAAAAAAGGGCATGG + Intronic
1132150745 15:99456382-99456404 ATTCACATGCAGGGTGGAAATGG + Intergenic
1133396786 16:5453843-5453865 GTTCTCATGCAGAAGGAGAAAGG + Intergenic
1134233032 16:12443842-12443864 CTTCACTTGCAAAAAGGGTATGG + Intronic
1135254966 16:20933799-20933821 ATCCAGATCCAGAAAGGGAAGGG - Intronic
1135965804 16:27034064-27034086 ATGCACAGGCAGAAGGAGAAAGG + Intergenic
1136369986 16:29830373-29830395 ATGCAGATGCGGACAGGGAAGGG + Intronic
1136706863 16:32197871-32197893 ATTCACATTTAGTAAAGGAAGGG + Intergenic
1136748728 16:32614567-32614589 GTCCACATGGAGAAAGGAAATGG + Intergenic
1136761048 16:32731546-32731568 ATTCACATTTAGTAAAGGAAGGG - Intergenic
1136807055 16:33138840-33138862 ATTCACATTTAGTAAAGGAAGGG + Intergenic
1136852728 16:33625955-33625977 TTTCCCTTGAAGAAAGGGAATGG + Intergenic
1137223081 16:46474691-46474713 ATTCAGATAAAGAAGGGGAAAGG - Intergenic
1137526262 16:49239056-49239078 ATTCCCATGATGGAAGGGAAAGG + Intergenic
1138390197 16:56664806-56664828 AATGACATGAAGAATGGGAAAGG + Intronic
1139062474 16:63270115-63270137 CTTCACAGGCAGAATGGGACAGG - Intergenic
1203050862 16_KI270728v1_random:873781-873803 GTCCACATGGAGAAAGGAAATGG + Intergenic
1203063200 16_KI270728v1_random:991863-991885 ATTCACATTTAGTAAAGGAAGGG - Intergenic
1203114331 16_KI270728v1_random:1474423-1474445 TTTCCCTTGAAGAAAGGGAATGG + Intergenic
1143594935 17:7908521-7908543 ATACACATGCAAGAAGGAAAAGG + Intronic
1144837055 17:18162003-18162025 ATTCAGAGGCAGGAAGGGTAAGG - Intronic
1145289834 17:21534390-21534412 TGTGTCATGCAGAAAGGGAAAGG - Exonic
1145934530 17:28706999-28707021 ATGCAGATGCTGACAGGGAAAGG + Intronic
1149189186 17:54038118-54038140 ATTCACAGGCAAAAAGTAAAGGG - Intergenic
1149940438 17:60859383-60859405 ATTCACATGGACACAAGGAAGGG - Intronic
1153016764 18:589720-589742 TCTAACATGCAGAAAGGGAAAGG - Intergenic
1157147209 18:45176001-45176023 ATTCATGTGAAGAAACGGAATGG + Intergenic
1158985661 18:62813808-62813830 ATTAAAATGCTGAAAGGGAAAGG - Intronic
1159657928 18:71055207-71055229 ATCCACCTTCAGAAAGTGAATGG + Intergenic
1159878703 18:73837492-73837514 ATTCACATGCAGGCAAGGAGAGG - Intergenic
1162311645 19:9911390-9911412 ATTCACCTGCTGAAAGCCAATGG - Intronic
1163661892 19:18583201-18583223 ATTCCCCTGCAGAAATGGAATGG + Intronic
1164515185 19:28928258-28928280 ATTCTCATCCAGAAAGTGGAGGG + Intergenic
1164549429 19:29196571-29196593 ATGCATATGCAGAAAGAGATTGG - Intergenic
925340683 2:3133409-3133431 ATTCAGCTTCAGAAAAGGAAGGG + Intergenic
925386886 2:3468186-3468208 TTGCACAAGCAGAAAGAGAAGGG - Intronic
925425130 2:3743028-3743050 ATGCACAGGCTGAAATGGAAGGG + Intronic
925961619 2:9022348-9022370 ATTTACTTGCAGAAATGGAAAGG - Intergenic
926457668 2:13088050-13088072 ATTCACATGTTGCAAGAGAAAGG - Intergenic
926690284 2:15728507-15728529 ATTCTACTGCAGAAAGGGGAAGG - Intronic
927364939 2:22283726-22283748 ATTCACATTCGGTCAGGGAAGGG + Intergenic
927585011 2:24294898-24294920 CTTCACATGCAGAAAGGGTAAGG - Intronic
927736629 2:25529296-25529318 ATTCAAATGCAGAAAGCGAGCGG + Intronic
928707137 2:33962251-33962273 ATTCAGTTAAAGAAAGGGAAAGG + Intergenic
930462613 2:51702507-51702529 ATACTCAAGAAGAAAGGGAATGG - Intergenic
932472917 2:71974529-71974551 ATTTAAATGGAAAAAGGGAATGG + Intergenic
932753520 2:74388475-74388497 TTGCAGATGCATAAAGGGAAAGG - Intronic
933889052 2:86749058-86749080 ATTCAAATGCATAAAGGAATGGG - Intronic
936557813 2:113511444-113511466 ATTAACATCCTGAAAGGGAGAGG + Intergenic
936583728 2:113731893-113731915 TTTCACATGTAAAATGGGAATGG - Intronic
937231529 2:120400800-120400822 ATTCACGTGCAGAGAGGCAGGGG - Intergenic
937818503 2:126280630-126280652 ATTCACATACAAAGAGAGAAGGG + Intergenic
938392914 2:130918894-130918916 ATACAGATGTAGAAAGGAAAAGG + Intronic
938801898 2:134771377-134771399 ATTCACATCCAGTAGGGGGAGGG + Intergenic
939645028 2:144686973-144686995 ATTCACATTGAGAAAGGAAAGGG + Intergenic
940086064 2:149860505-149860527 GATCACATGACGAAAGGGAAGGG + Intergenic
940262625 2:151798105-151798127 ATACACATGCACAAATGAAATGG + Intronic
940533264 2:154906273-154906295 ATTTACATACTGAAAGGTAAAGG - Intergenic
940704434 2:157086112-157086134 CTGCACTGGCAGAAAGGGAAAGG - Intergenic
940815960 2:158297893-158297915 ATTCAGATGGATAAAGAGAAAGG - Intronic
940991019 2:160096649-160096671 ATTGACATGCAGAAACAGATTGG - Intergenic
941202889 2:162536123-162536145 ATTCAGATGCAATAAAGGAAAGG + Intronic
942189939 2:173459320-173459342 ATGCACATCCTGTAAGGGAAGGG - Intergenic
942971539 2:181962831-181962853 ATCCACATGAAGACAGGGGAAGG + Intronic
943202843 2:184851370-184851392 ACTCAGAAGCAGAAAGAGAATGG - Intronic
943563528 2:189491231-189491253 ATTCAATTGTAGAATGGGAATGG + Intergenic
945635795 2:212348937-212348959 ATTCACATAAAGAAAGAGAGCGG + Intronic
946476484 2:220011285-220011307 ACTCACAATCAGAAAGGGGAGGG - Intergenic
947264422 2:228261231-228261253 ATTGAAAAACAGAAAGGGAATGG + Intergenic
947622473 2:231599504-231599526 TTTTTCAGGCAGAAAGGGAAAGG - Intergenic
947876103 2:233469268-233469290 GTTCACAAGCCGAATGGGAAGGG + Intronic
1169220447 20:3819502-3819524 ATTCACATGCCAAGAGGTAAAGG + Intergenic
1169563388 20:6826435-6826457 AGTCACATTCAGAAAGGCAGTGG + Intergenic
1173011231 20:39184539-39184561 ATTAACAAGCCTAAAGGGAATGG - Intergenic
1173851163 20:46219152-46219174 GATCACATGCAGATATGGAATGG + Intronic
1174340307 20:49891193-49891215 TTTCACATGCAGAAGAGAAAAGG + Exonic
1174531290 20:51216432-51216454 AGTCACATGGACAGAGGGAATGG + Intergenic
1175701892 20:61145196-61145218 ATTTAGATACAGAAAGGCAATGG - Intergenic
1176158706 20:63637383-63637405 TTTCCCATGAAGAAAAGGAAAGG - Intergenic
1176729968 21:10484226-10484248 ATACACATGAACAAAAGGAATGG - Intergenic
1177529635 21:22342534-22342556 ATTAACATGCAAAAAGGAATGGG - Intergenic
1178399027 21:32267365-32267387 ATACACGTGCAGAGATGGAAAGG + Intergenic
1178777132 21:35562602-35562624 ATTCACATGGTGGAAGGAAAGGG - Intronic
1178831265 21:36058872-36058894 TTTAGCATGCAGAAAGGAAAAGG - Exonic
1179177328 21:39018309-39018331 ATTCACATCCAGAAAGCTGAGGG - Intergenic
1179225849 21:39452272-39452294 AATCAAATGCAGAAAGCAAAGGG - Intronic
1179239754 21:39579727-39579749 GTTCCCAGGCAAAAAGGGAAAGG - Intronic
1180234262 21:46447853-46447875 ATTCATATGCAGAATAGGAATGG + Intergenic
1181685156 22:24523087-24523109 ATAGAGATGCAGAAAGGGCAGGG + Intronic
1182973201 22:34596891-34596913 ATACACATGGAGACAGGGAGAGG - Intergenic
1184185418 22:42861658-42861680 ATTCAAATGCAAAAAAGGAGGGG + Intronic
1184806699 22:46799301-46799323 ACACACATGCAGAATGGTAATGG - Intronic
1184950988 22:47842488-47842510 AGTCTCATGCAGAAGGGGCAGGG - Intergenic
1185192522 22:49447613-49447635 ATTCTCATGAAGAAAGTAAATGG - Intronic
949458130 3:4261236-4261258 AATAACATGCAGAGAGAGAAGGG + Intronic
949576509 3:5343597-5343619 ATTCAGATGCTGAATGGGAAAGG - Intergenic
949832654 3:8232576-8232598 ATTCAGATGAAGAGAGGGAAGGG - Intergenic
949910989 3:8907831-8907853 ACCCACATGCTGAAAGGGCAGGG + Intronic
950335222 3:12187875-12187897 CTTCCCAGGAAGAAAGGGAAGGG - Intronic
950348459 3:12322513-12322535 ATACACGTGCAGAACTGGAATGG + Intronic
950723632 3:14901769-14901791 ATCCACAGGCAGAAGAGGAAGGG + Intronic
951155493 3:19348363-19348385 ATCAACATGCTGAAAGGGCACGG - Intronic
951354945 3:21654528-21654550 ATTTACATGTAGAAAAGGAAGGG - Intronic
951461517 3:22956440-22956462 ATTCTCATTCAAAAAGGGAAAGG + Intergenic
952282336 3:31935834-31935856 TTTCATATGTAGAAAGGGAAAGG + Intronic
952685672 3:36145380-36145402 CCTCACATGGAGAAAGGGCAAGG + Intergenic
952937487 3:38411663-38411685 ATTCTCATGTAGAATAGGAAAGG - Intronic
953009740 3:39013548-39013570 AGTCACAGGAAGAAAGGGAGAGG + Intergenic
953126258 3:40094299-40094321 ATTCACTTGCAAAAGGGAAATGG - Intronic
953301475 3:41780913-41780935 ATTCCCACACAGAAAGGGGAAGG + Intronic
955887057 3:63611629-63611651 ACAAACATGCAGAAAGGGACAGG - Intronic
956226162 3:66961675-66961697 ATACAAATACAGAAAGGGAAAGG - Intergenic
956516704 3:70057275-70057297 ATTCAAAAGTAGAGAGGGAAGGG - Intergenic
957938424 3:86973722-86973744 AGTCAAATGGAGAAAGGAAAAGG - Intronic
958701961 3:97603040-97603062 ATTCACATTTAGAAAAGTAATGG - Intronic
958758094 3:98274425-98274447 ATTCATAGGCAGACAGGGGAAGG + Intergenic
958766311 3:98372447-98372469 ATTCTCATGGTCAAAGGGAAGGG + Intergenic
959346516 3:105201674-105201696 TTTCACATTCAGAAACTGAAAGG - Intergenic
959613422 3:108320287-108320309 TTTCACATGCAGAAAATAAAAGG - Intronic
959661648 3:108875184-108875206 CTTGACATGGAGAAAGAGAAAGG + Intergenic
959920164 3:111860150-111860172 ATGCACATGGAGAGAGGGATGGG + Intronic
960181727 3:114588042-114588064 ATACACATGAAGAGAGAGAAAGG - Intronic
961094183 3:124140718-124140740 AGTCACAGGGAGAATGGGAATGG - Intronic
962256900 3:133877230-133877252 AGGGAGATGCAGAAAGGGAATGG + Intronic
962473956 3:135739727-135739749 ATTCAAATGCATAAAGTGGAGGG - Intergenic
962538599 3:136354900-136354922 ATACAAAGGCAGAAAGTGAAAGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963332816 3:143934559-143934581 TATCACAGGTAGAAAGGGAAAGG - Intergenic
963728335 3:148946627-148946649 ATTCACTTTCAGAAAAGAAATGG - Intergenic
964602602 3:158518173-158518195 ATGCAGATGCAAAAAGGGTATGG - Intronic
964890756 3:161531879-161531901 ATACACATGTATATAGGGAAAGG - Intergenic
965144223 3:164878909-164878931 ATTCATAGGCAGACAGGGACAGG + Intergenic
965169947 3:165250120-165250142 ATGCATATTCAGAAAGGTAAAGG + Intergenic
966268109 3:178071128-178071150 TTTCACAGGCAGAAAGGAGAAGG - Intergenic
967658775 3:192079804-192079826 ATTCACAGGAGGAAAGGGGAAGG - Intergenic
967871528 3:194233887-194233909 ATTCGGATGCAGAAAAGGTAGGG - Intergenic
968176812 3:196557642-196557664 TTTCAGATGCAGAAAGGGGCAGG + Intronic
971055860 4:22911496-22911518 ATTCAAGTGCAGCAATGGAAAGG - Intergenic
971082285 4:23227239-23227261 ATTCACTTGCAGAATGAGTAGGG + Intergenic
971256000 4:25013960-25013982 GTTCACATGTAGACAGAGAAAGG + Intronic
971643439 4:29165120-29165142 ATTCACACTCAGAAATGAAATGG + Intergenic
972834395 4:42851739-42851761 ATACACAGGCTGAAAGTGAAGGG - Intergenic
972962615 4:44472773-44472795 AATTAGATGTAGAAAGGGAAGGG + Intergenic
973025297 4:45261354-45261376 AATCACATGGCAAAAGGGAAAGG + Intergenic
973107927 4:46362771-46362793 ATTTACATGCAGCAAAGCAATGG + Intronic
973642156 4:52914075-52914097 ATTCTTATGCAGAAGGGAAAAGG - Intronic
974699180 4:65417047-65417069 GTTCACATGCAGTGAGGGGACGG + Intronic
975591231 4:76002012-76002034 TCTCCCATGAAGAAAGGGAACGG - Exonic
975737970 4:77400210-77400232 ATTCACATGCAGAGAGAGTCAGG - Intronic
975740418 4:77424175-77424197 ATTCACATGCTGAAACTTAATGG - Intronic
976043422 4:80915360-80915382 ATTCACATGCAGAGAAAAAAGGG - Intronic
977556865 4:98495692-98495714 ATGCACATGCAGAAACGAAAAGG + Intronic
977988278 4:103411600-103411622 ATCCACAAGCACAAAGAGAATGG - Intergenic
978491868 4:109318501-109318523 ATTCTCCTGCAGAAACAGAATGG + Intergenic
979305531 4:119138701-119138723 ATTCTGATGCACAAGGGGAAAGG - Intronic
980334432 4:131452324-131452346 ATACATATGCAGATAGAGAAAGG - Intergenic
980734809 4:136870761-136870783 ATTGAGATGCGGAAAGGGGAGGG + Intergenic
981617193 4:146654650-146654672 ATACACACGGAGAAAGAGAAGGG + Intergenic
983541352 4:168914181-168914203 CTTGTGATGCAGAAAGGGAATGG + Intronic
984512912 4:180700505-180700527 TTTCACATGCACAACTGGAAAGG + Intergenic
985483944 5:138484-138506 ACACACATGCAGATGGGGAAAGG - Intergenic
985837005 5:2278905-2278927 GTTCACTTGGAGGAAGGGAAGGG + Intergenic
986374866 5:7120131-7120153 ATTCTCATGCAACAAGGGTAAGG - Intergenic
987489598 5:18560803-18560825 ATTCAAATGCAGAAAAGAAAGGG + Intergenic
988320368 5:29686791-29686813 ATTCACATGGTGGAAGGGAATGG - Intergenic
989162158 5:38401695-38401717 AGTGACATGGAGGAAGGGAAAGG + Intronic
989439082 5:41448965-41448987 TTGCAGGTGCAGAAAGGGAAAGG - Intronic
990044796 5:51415911-51415933 AGTCACAGGAAGAAATGGAATGG + Intergenic
990465451 5:56067244-56067266 CCTCACATGGAGAAAGGGTAAGG - Intergenic
991049153 5:62254193-62254215 TTTCCCTTGAAGAAAGGGAATGG - Intergenic
991165498 5:63562333-63562355 ATTCATAGGCAGATAGGGACAGG + Intergenic
991244243 5:64492154-64492176 ATTCACATGTAGCAAAGGCATGG + Intergenic
991451793 5:66759370-66759392 AGTCCAATGAAGAAAGGGAAAGG - Intronic
992394239 5:76357077-76357099 ATTGACCTCCAGGAAGGGAAGGG + Intergenic
993525696 5:88963228-88963250 TTTCACATGCAAAAAGAGTATGG + Intergenic
994946493 5:106399947-106399969 ATTCATAGGCAGAAGAGGAAAGG + Intergenic
995416912 5:111922817-111922839 ATTCTCCTGCAGAAACAGAATGG - Intronic
996993335 5:129663941-129663963 ATTCACATGCATACAGAAAAAGG - Intronic
997929863 5:138063347-138063369 AGTAGCATGCAAAAAGGGAAAGG - Intergenic
999310684 5:150549798-150549820 AATAACCTGCAGAAAGGAAAAGG - Intronic
999816139 5:155178244-155178266 CTTCACATGGTGAAAGGGCAAGG - Intergenic
1000180482 5:158805443-158805465 ATTCATATTCAGATAAGGAAAGG - Intronic
1001423953 5:171611311-171611333 ATTCTCTTGGAAAAAGGGAATGG - Intergenic
1002022959 5:176376563-176376585 TTTCCCATAAAGAAAGGGAAAGG + Exonic
1002256076 5:177959321-177959343 GTTGACATGGAGAAAGGAAACGG + Intergenic
1002556971 5:180049821-180049843 ATTCAGAGGCAGAAAGGAGAGGG - Intronic
1003627926 6:7760318-7760340 ATTCACATGCAGACTGACAAAGG - Intronic
1003654347 6:7991892-7991914 AGTCACATGGAGAAACAGAATGG + Intronic
1003970097 6:11291010-11291032 TTTCACATGCTGGAAGTGAAAGG + Intronic
1004069639 6:12287221-12287243 AGTCACTCTCAGAAAGGGAAGGG - Intergenic
1004342403 6:14819058-14819080 ATACAGATGCAGAGAAGGAATGG - Intergenic
1004759118 6:18646587-18646609 ATTCTCTTGAAGAAAAGGAAAGG - Intergenic
1005088428 6:22031428-22031450 ATTCACATCCAGAGCAGGAACGG - Intergenic
1005214519 6:23509606-23509628 CCTCACATGGAGGAAGGGAAAGG - Intergenic
1006220485 6:32485261-32485283 TTACACATGCAGAAGTGGAAAGG - Intergenic
1006229527 6:32571318-32571340 TTACACATGCAGAAGTGGAAAGG - Intronic
1007866819 6:44980207-44980229 AGACAAATGCAGAAAGGGTAGGG + Intronic
1008012835 6:46487448-46487470 AACGACATGTAGAAAGGGAAAGG - Intronic
1009619412 6:66053604-66053626 AATCAAATGCAAAAAGGCAAAGG + Intergenic
1009749324 6:67862729-67862751 ATCCACATGTTGCAAGGGAAAGG + Intergenic
1009856146 6:69266807-69266829 ATGCATATTCAGAAAGGTAAAGG + Intronic
1010201488 6:73285994-73286016 AATCACATTTAGGAAGGGAAAGG + Intronic
1010614842 6:78000077-78000099 ACAAACATGGAGAAAGGGAATGG + Intergenic
1010847366 6:80725798-80725820 ATTCACATGCCGCCAGAGAAAGG - Intergenic
1011415182 6:87111577-87111599 AATCACATGCAGCAAGGTACAGG - Intergenic
1013442743 6:110187820-110187842 ATTAAAATGCAGTAAGTGAAGGG - Intronic
1013629192 6:111968898-111968920 CTTCTCATGCAGAAATGGCATGG - Intergenic
1014096700 6:117469191-117469213 ATTCCCATTCAGACAGGGTAAGG + Intronic
1014477153 6:121887963-121887985 ATTCTCATGCTGGAAGGGAGAGG + Intergenic
1014550167 6:122781123-122781145 GTTCACATACAGAAATGGGATGG + Exonic
1014588707 6:123234232-123234254 GGTCACATGCTGAAATGGAATGG - Intronic
1014688108 6:124529335-124529357 ATGCACAAACAGAAAGAGAAGGG - Intronic
1014858622 6:126434461-126434483 ATTCACAAGAAGAAATGTAATGG - Intergenic
1014897267 6:126917582-126917604 ATTGAAATGCAGTAAAGGAAGGG + Intergenic
1016271762 6:142298241-142298263 ACTCACATGCACACAGGAAAGGG + Intergenic
1016872099 6:148828043-148828065 ATTAAGATTCAGAAAGTGAATGG - Intronic
1017064305 6:150515222-150515244 ATTTACATGCACAGAGGAAAGGG + Intergenic
1017229359 6:152055623-152055645 ATTCTCAAGCAAAAATGGAAGGG - Intronic
1018038379 6:159900854-159900876 ATTCAGATGCAAAAAGGATAAGG + Intergenic
1018552379 6:165012486-165012508 ATTTTCATGCAGAATGGGGAAGG - Intergenic
1019054035 6:169207620-169207642 CTTCACAGGTAGGAAGGGAATGG + Intergenic
1020994983 7:15252103-15252125 ATTCCCATGCAGTGAGGAAAGGG + Intronic
1021105452 7:16634063-16634085 TTTCTCATGCAGAAGGGAAAGGG - Intronic
1022621741 7:31991505-31991527 AGTTACCTGCAGAAGGGGAATGG + Intronic
1023215563 7:37859003-37859025 GTTCTCATGGAGGAAGGGAAAGG - Intronic
1023510516 7:40948219-40948241 ATTTTCATGCAGAGAAGGAATGG - Intergenic
1026253266 7:68689359-68689381 ATTGCCATGCAGAAAAGGAGTGG + Intergenic
1027239452 7:76317896-76317918 ATTCAGATGGAGAAACTGAAGGG + Intergenic
1027260935 7:76464134-76464156 ACCCACATCCAGAAAGGGGACGG + Intronic
1027312313 7:76962246-76962268 ACCCACATCCAGAAAGGGGACGG + Intergenic
1027597127 7:80187427-80187449 AATCACATGCAGAGTGGGTAAGG + Intronic
1028251290 7:88542428-88542450 ATTCCCCTGCAGAAATAGAACGG - Intergenic
1028531013 7:91838676-91838698 AGTCACATGCATTAAGGGAATGG + Intronic
1028639234 7:93024403-93024425 TTTCACATGCAGGGAGGGAGAGG - Intergenic
1029881292 7:103813157-103813179 ATTAATATGTAGAAAGAGAAAGG - Intronic
1030824870 7:114142712-114142734 ATCCACATGGAGAAAGGAAGAGG - Intronic
1032107733 7:129048573-129048595 ATTCAGGTACAGAAAGGGAGAGG - Intronic
1032145167 7:129372876-129372898 GTTCACAGGCAGAAAAGTAAAGG - Intronic
1032846186 7:135753922-135753944 ATTCTCATGTAGAAAGTGAGAGG + Intergenic
1033978114 7:147126971-147126993 AATCCCCTGCAGAAAGTGAAAGG + Intronic
1034481957 7:151328730-151328752 ATTCTTATGCAGAAGGAGAAAGG + Intergenic
1034516726 7:151586796-151586818 ATTAAGAGGCACAAAGGGAAGGG - Intronic
1034599608 7:152237307-152237329 ATACACATGAACAAAAGGAACGG + Intronic
1035441082 7:158900667-158900689 ATTCACATGTATAATGGGGATGG - Intronic
1036070048 8:5432143-5432165 ATACACAGGCTGAAAGTGAAAGG + Intergenic
1036480391 8:9134074-9134096 AATCCCATGCAGAAAGCAAAAGG + Intergenic
1036536071 8:9653930-9653952 ATGCAGATGCAGACAGGAAATGG - Intronic
1037312184 8:17567978-17568000 ATTCACAAGCAGAAACAGAAAGG - Exonic
1037391574 8:18398357-18398379 ATTCATACACAGAAAGGGAGAGG + Intronic
1037937300 8:22923789-22923811 CTTCACATGGGGGAAGGGAAGGG - Intronic
1038134043 8:24766675-24766697 ATTCAGAGGCAGAAGGGGAGGGG + Intergenic
1038351763 8:26782412-26782434 TTTAACACGCAGAAAGGGATTGG + Intronic
1039908715 8:41807474-41807496 ATTCACAGGAAGAAGGTGAAAGG - Intronic
1040789462 8:51209061-51209083 ATTTTCATGAATAAAGGGAAAGG - Intergenic
1040899138 8:52400270-52400292 ATACACAGGCTGAAAGTGAAGGG - Intronic
1041313529 8:56539647-56539669 ACACACATGCAGAGAGAGAAAGG + Intergenic
1041396677 8:57398807-57398829 ATTCACAAGCACACAAGGAATGG - Intergenic
1041557734 8:59176892-59176914 ATTCACCTGCAGCAAGGTAAAGG - Intergenic
1041699770 8:60775124-60775146 AAACACAAGCAGAAAGGCAAAGG + Intronic
1042215065 8:66423026-66423048 GCTCATATGCAGAAAGGCAATGG - Intergenic
1042392566 8:68252932-68252954 ATTATCATGGAAAAAGGGAAAGG - Intergenic
1042836815 8:73086470-73086492 ATACACATGGAGAAAAAGAAAGG - Intronic
1044293137 8:90496148-90496170 ATACACATGCACAAATGAAATGG - Intergenic
1044418842 8:91967857-91967879 CTTCAAATAAAGAAAGGGAAAGG + Intronic
1045810438 8:106214939-106214961 ATAGACATGCAGAAAGAGCAGGG + Intergenic
1046040956 8:108903866-108903888 TTCAACATGCAGAAAGGCAAAGG - Intergenic
1046379752 8:113435868-113435890 ATTCCCAAGCAGGAAGGCAAGGG - Intronic
1046908195 8:119597022-119597044 ATTCAGATGCAGGAAGGGGCGGG + Intronic
1047708249 8:127524045-127524067 ACTTACAAGCAGATAGGGAAAGG + Intergenic
1047722357 8:127652997-127653019 ATTCAAATGCAGAACAGGATTGG - Intergenic
1048189049 8:132271758-132271780 TTCCACATCCAGAAAAGGAAAGG - Intronic
1048520102 8:135145967-135145989 ATCCATATGCAGAAAGAGAATGG - Intergenic
1049894999 9:104665-104687 ATTAACATCCTGAAAGGGAGAGG - Intergenic
1050837861 9:10106852-10106874 AGTGACATACAGAAAGGAAAGGG + Intronic
1051633572 9:19161860-19161882 AGTCCCATGCACAAAGTGAAAGG + Intergenic
1051842228 9:21412078-21412100 ATTTATATGCAGTCAGGGAATGG + Intronic
1052341757 9:27370537-27370559 CTTCACATGGAGAAAGAAAAAGG - Intronic
1052777060 9:32742825-32742847 ATTGACATGATGAAAGGGAAGGG + Intergenic
1053097676 9:35342691-35342713 ATGCACATGCAGGAGAGGAATGG - Intronic
1053737405 9:41109805-41109827 ATTAACATCCTGAAAGGGAGAGG - Intergenic
1054690944 9:68321514-68321536 ATTAACATCCTGAAAGGGAGAGG + Intergenic
1055420672 9:76137894-76137916 TTTCCTAAGCAGAAAGGGAAGGG - Intronic
1056459968 9:86800142-86800164 ACTCAAATGCAGAAAGGGTTGGG + Intergenic
1056539919 9:87562087-87562109 ATTCTCATGGGGAGAGGGAAGGG + Intronic
1056631282 9:88295108-88295130 ATTCCCATTCAGAGAGGGTAAGG + Intergenic
1057434853 9:95030609-95030631 GGCCACATGCAGAAAGGCAAAGG - Intronic
1058797892 9:108516121-108516143 ATAAACACCCAGAAAGGGAAGGG - Intergenic
1059081142 9:111251652-111251674 ATTGAGATGCAAAAAGGAAATGG + Intergenic
1059946028 9:119409244-119409266 ATTGACAGGCAGAGAGAGAAAGG - Intergenic
1060119171 9:120972175-120972197 ATTTACATGTAGAAGGGAAAGGG - Intronic
1060521723 9:124297862-124297884 GTTCAGATGCAGAAAGGCCAAGG - Intronic
1062384617 9:136304237-136304259 AATGACATGCAGGGAGGGAATGG + Intronic
1203584311 Un_KI270746v1:49847-49869 ATACACATGAACAAAAGGAACGG + Intergenic
1186294009 X:8129093-8129115 ATCCACATGCTGCAAGTGAAAGG + Intergenic
1186325203 X:8468125-8468147 GTTCACAGGCAAAAAGAGAAAGG + Intergenic
1186670719 X:11764847-11764869 ACTGACATGGGGAAAGGGAAAGG - Intronic
1187370268 X:18699667-18699689 CTTCATCAGCAGAAAGGGAAAGG - Intronic
1188344074 X:29042678-29042700 ATACAAATCTAGAAAGGGAAAGG - Intronic
1188416496 X:29941505-29941527 ATTCTCATGCAAAAAGGAAAGGG + Intronic
1189592327 X:42527597-42527619 ATTTATATACAGAAAGAGAATGG - Intergenic
1189620802 X:42835223-42835245 ACTCACATAGAGAAAGGGAAGGG + Intergenic
1189823557 X:44894246-44894268 ATTCTCATCCAGAAATAGAAGGG - Intronic
1190039571 X:47058929-47058951 ATTCAGAGGCAGAAAGTGATGGG + Exonic
1190584301 X:51922716-51922738 AGGCAGATGCAGAGAGGGAAAGG - Intergenic
1192249026 X:69395919-69395941 ATTTACATACAGCAACGGAAAGG - Intergenic
1194063363 X:89232471-89232493 ATTCACATAAAGAAAGGGGCAGG - Intergenic
1194414368 X:93592277-93592299 ATTGACATGTAGGCAGGGAATGG - Intergenic
1194492390 X:94568075-94568097 TTCCACTTGCAGAAAGGAAAAGG - Intergenic
1194759672 X:97780601-97780623 ATTCACATGAAGAAATGAAGAGG + Intergenic
1196062421 X:111425137-111425159 AATCACATGCAGGAAAGCAATGG + Intergenic
1197776129 X:130119749-130119771 CTTCCCATAAAGAAAGGGAAGGG - Intergenic
1198250509 X:134875204-134875226 ATTCAAGTGCAGAAAAGGAAGGG + Intergenic
1198251834 X:134886634-134886656 ATTCACATACAGAGAGGAATTGG - Intergenic
1198912564 X:141630842-141630864 ATTTACATGGTCAAAGGGAAGGG + Intronic
1199512682 X:148639942-148639964 ATTCTAATGCAGATAGAGAAAGG + Intronic
1200717537 Y:6566583-6566605 ATTCACATAAAGAAAGGGGCAGG - Intergenic
1201438337 Y:13983963-13983985 GTTCACAGGCAAAAAGAGAAAGG - Intergenic
1201532353 Y:15005867-15005889 ATTCACCCTCAGAAAAGGAAAGG + Intergenic