ID: 1074459722

View in Genome Browser
Species Human (GRCh38)
Location 10:113625966-113625988
Sequence GCGGCACCTGCTGTTGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074459714_1074459722 24 Left 1074459714 10:113625919-113625941 CCAGCCTATTTAGAGGGAAGGCT 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1074459722 10:113625966-113625988 GCGGCACCTGCTGTTGTCCCTGG 0: 1
1: 0
2: 2
3: 22
4: 189
1074459715_1074459722 20 Left 1074459715 10:113625923-113625945 CCTATTTAGAGGGAAGGCTCTTT 0: 1
1: 0
2: 0
3: 7
4: 119
Right 1074459722 10:113625966-113625988 GCGGCACCTGCTGTTGTCCCTGG 0: 1
1: 0
2: 2
3: 22
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074459722 Original CRISPR GCGGCACCTGCTGTTGTCCC TGG Intronic
900291246 1:1924430-1924452 GCGGCAGCTGCTGCTGGCCCCGG + Exonic
900362677 1:2297504-2297526 GCTCCACCTGCTGTGGCCCCAGG + Intronic
900365537 1:2310623-2310645 GCCGCACCTGCGGTTGGCCAAGG + Intergenic
900385073 1:2406799-2406821 GCTGCACCTGGTGCTGTCCATGG - Exonic
900489489 1:2939849-2939871 GCGATACCTGCCTTTGTCCCTGG - Intergenic
902224951 1:14990933-14990955 TCCCCACCTGCTGTTTTCCCTGG - Intronic
904756489 1:32771241-32771263 GCCGCCCCTGCTGTGGTTCCTGG + Exonic
906686395 1:47766003-47766025 GCGGGTCCTGCTGTTGTAGCTGG + Exonic
906855377 1:49298556-49298578 CCAGCACCTGCTGTTGTTCAGGG - Intronic
913248118 1:116888164-116888186 GCAGCCCCTACTGTTGTCCTGGG + Intergenic
914805199 1:150986388-150986410 GCAGGACCTGCTGTTGGCCCTGG + Exonic
918066290 1:181104469-181104491 GCGGCTCCTTCAGTTGTCCTGGG - Intergenic
922806629 1:228393628-228393650 GGGGCACCCGCTATTGTTCCTGG + Intergenic
1063593109 10:7410831-7410853 GCCGCGCCGGCTGCTGTCCCCGG - Intronic
1064391569 10:14946748-14946770 GTGGCATGTGCTGTAGTCCCAGG - Intronic
1064644805 10:17450228-17450250 GTTGCACCTGCTGTTGCTCCTGG - Intronic
1065757974 10:28951761-28951783 GCAGCATCTTCTGTTGTCTCAGG + Intergenic
1065950727 10:30648361-30648383 GCTGCACCTTATGATGTCCCGGG + Intergenic
1066100899 10:32117574-32117596 GGGGCACATGCTGTTGTGCTGGG + Intergenic
1067786849 10:49256482-49256504 GGGGCTCCTGCTTTTGCCCCAGG + Intergenic
1070744273 10:78923444-78923466 GGGGCACCTTCTGGTGTCCCAGG + Intergenic
1073104096 10:101022384-101022406 GGGCCCCCTGCTGTTGTCCAGGG - Exonic
1073461023 10:103665955-103665977 GCTGGACCTGCTGGGGTCCCAGG + Intronic
1074459722 10:113625966-113625988 GCGGCACCTGCTGTTGTCCCTGG + Intronic
1075161370 10:120027624-120027646 GTGGCATGTGCTGTAGTCCCAGG + Intergenic
1075420482 10:122296914-122296936 GTGGCACCTGCTCCTGCCCCAGG + Intronic
1076002015 10:126919831-126919853 CCAGCACCTGCTGTGGTCCCTGG + Intronic
1076690698 10:132222650-132222672 GCTGTCCCTGCTGTTGTCCCGGG + Exonic
1077055923 11:593092-593114 GCTGCACCTGCTGCTCTCCCTGG + Intronic
1078138136 11:8669508-8669530 GTGGCACATGCTGTAGTCCCAGG + Intronic
1079590500 11:22177376-22177398 GCTGAAGCTGCTGATGTCCCTGG - Intergenic
1081700439 11:45149139-45149161 GAGGCTCTTGCTGTTGTCCTGGG - Intronic
1082771049 11:57207562-57207584 GCTCCACCTGGAGTTGTCCCAGG - Intergenic
1084660505 11:70543885-70543907 GGGGCACCTGCTGGTGTCCGAGG + Intronic
1090168598 11:124578166-124578188 GCCGCTGCTGCTGATGTCCCTGG + Intergenic
1090574515 11:128086434-128086456 GCACAACCTCCTGTTGTCCCAGG - Intergenic
1090699338 11:129279726-129279748 GCCTCGCCTGCTGTTGTCCCGGG + Intergenic
1090854677 11:130601248-130601270 CAGTCACCCGCTGTTGTCCCTGG - Intergenic
1091154629 11:133361632-133361654 GGGGCACCTGCAGCTATCCCGGG + Intronic
1094199377 12:27780681-27780703 GCTGCAGCTGCTGCTGTCCCAGG + Exonic
1094375600 12:29784361-29784383 GGCGCCGCTGCTGTTGTCCCGGG - Intronic
1094411283 12:30170506-30170528 GGTGCCGCTGCTGTTGTCCCGGG - Intergenic
1096075472 12:48801155-48801177 AAGGCTCCTGCTGTTGTCCCCGG - Intergenic
1096616924 12:52838536-52838558 GCTGCACCTGTTGCTGTCCTGGG - Intronic
1099758292 12:86884647-86884669 CCGGCACCTGCTGTCATGCCTGG + Intergenic
1101336292 12:103799862-103799884 AAGGCACCTGCTGTAGTCACTGG - Intronic
1101910772 12:108858695-108858717 GAGGCTGCTGCTGTTGTCCCGGG + Intergenic
1103209995 12:119158634-119158656 GGGGCACCTGCCCCTGTCCCAGG - Exonic
1103896593 12:124277583-124277605 GCTTCTCCTGCTGTTGGCCCTGG + Intronic
1104694737 12:130854670-130854692 GTGGCACCTGCTGTTCTCATTGG - Intergenic
1107360813 13:39616279-39616301 GCGACATCTGCTGTTATCACAGG + Intergenic
1117842131 14:59870694-59870716 GCGCTCCCTGCTGCTGTCCCCGG + Exonic
1119406304 14:74401733-74401755 GCAGCAGCGGCAGTTGTCCCTGG + Intergenic
1120904697 14:89610170-89610192 GCAGAACCTGCTGATGTCCTGGG + Intronic
1121312951 14:92944993-92945015 GCTGCACCTGCTGTAGCCACAGG + Intronic
1122479796 14:102039616-102039638 TCGTCTCCTGCTCTTGTCCCAGG + Exonic
1122793676 14:104195135-104195157 GCAGCCCCTGCTGCTGTCCCTGG - Intergenic
1122924180 14:104892180-104892202 GCAGGACCTGCTGGTGGCCCAGG + Intronic
1123061994 14:105598588-105598610 CCTGCACCTGCTGATGACCCGGG - Intergenic
1123086737 14:105720319-105720341 CCTGCACCTGCTGATGACCCGGG - Intergenic
1123709220 15:22974595-22974617 GTGGCACCTCCTGTAATCCCAGG + Intronic
1124156772 15:27233028-27233050 CAGGCACCTCCTCTTGTCCCTGG + Intronic
1125533463 15:40428881-40428903 GAGGCAGCTGCAGATGTCCCAGG - Intronic
1130960887 15:88657945-88657967 GCCGCACCTGCTGCTCTCCGGGG - Intergenic
1131092505 15:89633134-89633156 GCCCCACCTGCTGCTGTTCCAGG + Exonic
1134188004 16:12099511-12099533 GCTGCATCTGCTCCTGTCCCTGG - Intronic
1134231304 16:12432617-12432639 GCGTCACCTCCTGTAGGCCCAGG + Intronic
1135866327 16:26105729-26105751 GCTGCACCTGCTATTTCCCCAGG + Intronic
1136455633 16:30378327-30378349 GCGGCACCCGCGGAGGTCCCGGG + Exonic
1141678254 16:85529098-85529120 GCGGCGCCTGCAGTTGTCCAGGG + Intergenic
1142189792 16:88712570-88712592 GGGGCACCTGCCCGTGTCCCGGG + Intronic
1142591514 17:1008179-1008201 GCAGCTCCTGCTGTTACCCCAGG - Intronic
1143109978 17:4547760-4547782 GCGGCACCAGCTGGTGTCCTAGG - Intronic
1144284559 17:13761009-13761031 GCGACCCCTCCTGCTGTCCCTGG - Intergenic
1144738158 17:17566417-17566439 GAGGCACCTGTGGATGTCCCGGG - Intronic
1145781995 17:27569462-27569484 GCTCCACCTGCTGGTGGCCCTGG - Intronic
1145817493 17:27805970-27805992 GTGGCACCTGGGGTAGTCCCAGG + Intronic
1149868220 17:60162155-60162177 GCAGCACCTGCTGTGGCCTCTGG - Intronic
1151756917 17:76080374-76080396 GCTGCAGTTGCTGTGGTCCCGGG - Exonic
1151875402 17:76865340-76865362 GCGGCACCTGCTGCAGGGCCCGG - Intergenic
1152239746 17:79155104-79155126 GCGGGAGCTGCTGCTGCCCCGGG - Intronic
1152844940 17:82593881-82593903 GCGGCAGCTGCTGCTCTGCCTGG - Intronic
1153710105 18:7790065-7790087 GGGGCCTCTGCTGTTGCCCCAGG + Intronic
1153824846 18:8865897-8865919 ACGGTACCAGATGTTGTCCCGGG - Intergenic
1157854433 18:51092180-51092202 GTGGCAGCTGCTGTGGACCCTGG - Intergenic
1159926033 18:74269786-74269808 GTGACAATTGCTGTTGTCCCTGG - Intronic
1160789683 19:917764-917786 GCCGCACCTGCTGCCGTCCCGGG + Intronic
1161118624 19:2512979-2513001 GCCAAACCTGCTGTTGGCCCGGG - Exonic
1161120659 19:2524092-2524114 GCCGCACCTCCTGTTTTCCTTGG + Intronic
1161356501 19:3822080-3822102 GCGGCACCGGCTGCAGTACCGGG - Exonic
1161936969 19:7378207-7378229 GGGACACCTGCGTTTGTCCCTGG + Intronic
1162052259 19:8041679-8041701 ACGGCACCTGCTGTTCCCCCAGG - Intronic
1162423440 19:10579485-10579507 GTGGCACATGCTGTAATCCCAGG - Intronic
1163251129 19:16127028-16127050 GAGGCCCCAGCTGTTGTCCTGGG - Intronic
1163687349 19:18719336-18719358 GTGGCACCTGCTGCAGGCCCTGG - Intronic
1163931044 19:20392407-20392429 TAGGCACCTGCTGCTGTGCCCGG + Intergenic
1165429398 19:35763918-35763940 GTGGCGCATGCTGTAGTCCCAGG - Intronic
1167136421 19:47618843-47618865 GCTTCACCTGCAGGTGTCCCTGG - Intronic
1167265452 19:48480801-48480823 GCGGGACCCGCTGTTTACCCTGG - Intronic
1167652567 19:50740943-50740965 GCGGCTCCTACTGTTGTCCCAGG - Intergenic
933729344 2:85445415-85445437 GCGGCACCTGCAGCTGTTGCTGG + Intergenic
937366189 2:121263810-121263832 GAGGCAGCTGATGTTATCCCTGG - Intronic
938047896 2:128139695-128139717 GTGGCACCTGCTGTGGCGCCTGG + Intronic
939138451 2:138324310-138324332 GCAGCAAATCCTGTTGTCCCAGG - Intergenic
943672650 2:190680061-190680083 GCGGCACCTGCCACTGTCCAGGG + Intronic
948195515 2:236092895-236092917 GCGGCATCTGCCCTGGTCCCTGG - Intronic
948907497 2:240986784-240986806 GCTGCACCAGCTGTGGGCCCAGG + Intronic
948994537 2:241571818-241571840 GCAGTCCCTGCTGTTGTTCCAGG + Intronic
1171382049 20:24741729-24741751 GAGCCACCTTCTGTTGTCCCTGG - Intergenic
1174366119 20:50057569-50057591 CAGGCACCTGCTGTTTTCTCTGG - Intergenic
1174447910 20:50602682-50602704 GGGGGACTTGCTGTGGTCCCTGG - Intronic
1175950580 20:62581219-62581241 GCTGCAGCTACTGCTGTCCCTGG - Intergenic
1175990424 20:62785863-62785885 GCAGCACTTGCTGTTCTTCCAGG - Intergenic
1176144741 20:63560529-63560551 GCGGAGCCTGCTGGTGTCCACGG - Exonic
1176211993 20:63929137-63929159 GCGGAGCTTGCTTTTGTCCCTGG + Intronic
1176293709 21:5059534-5059556 CCCGCACCTGCTGTGGGCCCTGG - Intergenic
1176307202 21:5129974-5129996 GCCGCAGCTCCAGTTGTCCCAGG + Intergenic
1179140187 21:38718401-38718423 GTGGCAGATGCTGTTGTCCTTGG - Intergenic
1179482097 21:41685027-41685049 GCGGCAGCTGCGGGGGTCCCTGG + Intergenic
1179849857 21:44132056-44132078 GCCGCAGCTCCAGTTGTCCCAGG - Intergenic
1179863550 21:44204114-44204136 CCCGCACCTGCTGTGGGCCCTGG + Intergenic
1180149051 21:45938424-45938446 GCGGGCCGTGCTGCTGTCCCTGG + Intronic
1180188834 21:46153233-46153255 GCGGGAACTTCCGTTGTCCCGGG - Intronic
1181943866 22:26499808-26499830 GCTGCATCTGATTTTGTCCCTGG - Intronic
1182420460 22:30246208-30246230 GCGGCACCTGCTCCCGTCCCAGG + Intronic
1183035029 22:35134896-35134918 GTGGCACCTCATGCTGTCCCAGG + Intergenic
1183899200 22:40992271-40992293 GCGACTCCTGCTCTTCTCCCGGG - Intergenic
1184023677 22:41837989-41838011 GCAGAACGTCCTGTTGTCCCAGG + Intronic
1184283083 22:43450013-43450035 ATGGTACCTGCTGGTGTCCCTGG - Intronic
1184970904 22:48019191-48019213 GAGGCAGCTGCTGTTTTCTCGGG + Intergenic
1185269186 22:49920844-49920866 CCAGCCCCTGCTGCTGTCCCTGG + Intronic
1185279562 22:49964287-49964309 GAGGCAGCTGCTCTTCTCCCTGG - Intergenic
1185371336 22:50462270-50462292 GCGGCTCTTGCTGCTGTCCAGGG + Exonic
1185414851 22:50704374-50704396 GCGGCTCCCGCTTTTGGCCCCGG + Intergenic
950092484 3:10305649-10305671 TGGGCCCCTGCTGTTGTACCTGG - Exonic
952409477 3:33034334-33034356 TAGGCCCCTGCTGTTGTACCTGG + Intronic
952629815 3:35453100-35453122 GCGCAGCCTCCTGTTGTCCCTGG + Intergenic
956889671 3:73599761-73599783 GAGGCATCTGCTGGTGGCCCAGG - Intronic
961613754 3:128162517-128162539 GCGGCACCTTCTCTTGGCGCTGG + Intronic
961902541 3:130226878-130226900 GTGGCTGCTGCTGTTGTTCCAGG + Intergenic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
963062913 3:141239765-141239787 GTGGCACATGATGATGTCCCAGG - Intronic
966904013 3:184508710-184508732 GAGGCACCTCCTGCTGCCCCGGG - Intronic
967214550 3:187199352-187199374 GAGGAACCTGCTGTAGTCCTAGG + Intronic
968529804 4:1085608-1085630 GGGGCACCTGCTGCTCTCCCAGG + Intronic
968571775 4:1346089-1346111 GCAGCACCAGCTTCTGTCCCTGG - Intergenic
972787842 4:42344381-42344403 TCTGCACCTGGTGTTTTCCCTGG + Intergenic
974446611 4:61992517-61992539 GCCACACCTGCTGTTGTTTCTGG - Intronic
976554384 4:86433263-86433285 GAGGCAGCTCCTGTTGTCCAAGG - Intronic
981279147 4:142936887-142936909 GAGGCACCTGCTGTTGCTCATGG - Intergenic
981569089 4:146132482-146132504 GCTGCACCTGCTGCTGGCCTGGG + Intergenic
985682783 5:1265244-1265266 GCGGCCTCTGCTGTGGCCCCGGG + Intronic
985826627 5:2196609-2196631 GTGGCAGCTGCTGTTGACCCCGG - Intergenic
985907458 5:2852062-2852084 GCGGGCCCTGCTTTTCTCCCTGG + Intergenic
986308858 5:6536335-6536357 CCTGGACCTGCTGTTTTCCCTGG + Intergenic
987967625 5:24896139-24896161 GCAGAACCTTCTGTTGTCCTTGG - Intergenic
992175587 5:74146198-74146220 GGGGCCCCTGCCCTTGTCCCTGG - Intergenic
993140508 5:84027207-84027229 GCGACACATGCTGTTCTCCATGG - Intronic
997991399 5:138547144-138547166 GGGGCACATGCTGCTGTGCCTGG - Intergenic
1001483692 5:172105201-172105223 GTGGAACATGCTGCTGTCCCAGG + Intronic
1002296416 5:178233512-178233534 CCTGCACCTGCTGCAGTCCCAGG - Intergenic
1006259928 6:32859205-32859227 GTGGCATCTGCTGATGTCCGTGG - Intronic
1006828974 6:36957502-36957524 TTGGTTCCTGCTGTTGTCCCAGG + Intronic
1007417557 6:41700868-41700890 GCTGCTCCCCCTGTTGTCCCGGG - Intronic
1016840497 6:148519938-148519960 GCACCACCTTCTGGTGTCCCTGG + Intronic
1016996842 6:149966772-149966794 GTGGCTCCTGCTGTGGTCCTGGG - Intronic
1017001958 6:150003475-150003497 GTGGCTCCTGCTGTGGTCCTGGG + Intergenic
1017011674 6:150067898-150067920 GTGGCTCCTGCTGTGGTCCTGGG + Intronic
1017724078 6:157264874-157264896 GCGGCACCTGCTGCTCTAACGGG + Intergenic
1018745973 6:166762448-166762470 ACGGCACCTGGCGTAGTCCCTGG + Intronic
1020011855 7:4809552-4809574 GCGGGACCTGCCGTGGTGCCTGG - Intronic
1022414371 7:30165357-30165379 GAGGCTCCTGGTGTTGCCCCGGG + Intergenic
1022414926 7:30169589-30169611 GTGGCACCGGGTGTTCTCCCTGG + Intergenic
1028838578 7:95400985-95401007 GTGGCACCTGCTGTAGTCCCAGG - Intergenic
1033219428 7:139518523-139518545 GCTGCACCAGCTGTACTCCCAGG - Intergenic
1035302502 7:157906727-157906749 GGGGCACACGCTGTTCTCCCAGG + Intronic
1035737619 8:1900008-1900030 TCAGCACTTGCTGTCGTCCCTGG - Intronic
1036443588 8:8802826-8802848 GAGGCAACAGCTGTGGTCCCTGG + Intronic
1036459533 8:8939514-8939536 GATGCCCATGCTGTTGTCCCAGG - Intergenic
1037917956 8:22784135-22784157 GGGGCACCTGCTGTGGGCCAGGG - Intronic
1039392824 8:37195624-37195646 TCAGCAACTGCTGTTGTCCTCGG - Intergenic
1040072821 8:43202184-43202206 GAGGCAGCTGCTGGTGGCCCAGG + Exonic
1041182590 8:55264140-55264162 TTGGCACCTGCTGTTCTCACTGG + Intronic
1041798926 8:61776897-61776919 GAGGCACCTTCTTTTCTCCCTGG + Intergenic
1044756013 8:95461866-95461888 GTGACACCTGCTTTGGTCCCTGG - Intergenic
1045023556 8:98064701-98064723 GGGGAACCTGCTGCTGTCGCCGG - Exonic
1046670939 8:117055417-117055439 CCAGCAACTGCTGCTGTCCCTGG - Intronic
1049189061 8:141276522-141276544 GAGGAACCTGCTGTTTTCCTGGG - Intronic
1049399672 8:142419315-142419337 GCTGCACCTGCTGCTGCACCTGG - Intergenic
1049602614 8:143514929-143514951 GCCGCATCTGCTGTGGTCCTGGG + Intronic
1049682084 8:143923808-143923830 GCGGCAGCTGCAGCTGGCCCAGG - Exonic
1049741070 8:144241163-144241185 GTGGCACCTGCTGTTCTCTGAGG + Intronic
1049806895 8:144545158-144545180 GCGGCAGCTGGTGAAGTCCCTGG - Intronic
1050526651 9:6552253-6552275 GAGGCACCAGCTGTTGTTCCAGG + Intronic
1051613345 9:18982488-18982510 GAGGCAGCAGCTCTTGTCCCGGG - Intronic
1052035286 9:23673697-23673719 GAGGCCCCTGCTCTTGTACCTGG - Intergenic
1053165465 9:35841112-35841134 GCCACCCCTGCTTTTGTCCCAGG + Exonic
1055612017 9:78032392-78032414 GCGGCCCCTGCTGAAGTCGCGGG + Intergenic
1057779095 9:98035326-98035348 CCAGCACCTGCTGTGGTACCAGG + Intergenic
1060660652 9:125403305-125403327 GACGCATCTGATGTTGTCCCTGG + Intergenic
1061116966 9:128619868-128619890 GCGGCATCTGCAGCTGTCACTGG + Intronic
1061814685 9:133187644-133187666 GCGGGAGCTGCTGCTGGCCCGGG + Intergenic
1061877076 9:133549476-133549498 GTGGCACCTGCTGATGCCCTGGG - Intronic
1062203984 9:135325611-135325633 ACGTCAGCTGCTGTTGTCTCTGG + Intergenic
1062227692 9:135462638-135462660 GCTGCACTTGCTGTAGGCCCTGG - Intergenic
1062373115 9:136250307-136250329 GAGGCACCTGCTGGGCTCCCAGG + Intergenic
1062392294 9:136338675-136338697 GCGGCACCTGCTCATTGCCCAGG + Exonic
1062506942 9:136882412-136882434 GCAGCATCTGCTGTGGTCCATGG + Intronic
1187391776 X:18890884-18890906 GCCCCACCCGCTGCTGTCCCTGG - Intergenic
1188324575 X:28785255-28785277 GTAGCACATGCTGTAGTCCCAGG - Intronic
1191046797 X:56146965-56146987 GTAGCAGTTGCTGTTGTCCCTGG + Intergenic
1197440714 X:126485643-126485665 GCTGCCCCTGCTGTTGTTACAGG - Intergenic
1200045250 X:153397481-153397503 ACAGCACCTGCTGTAGTCGCAGG + Intergenic
1202102739 Y:21327774-21327796 GTCGCACCTGCTATTCTCCCTGG + Intergenic