ID: 1074461542

View in Genome Browser
Species Human (GRCh38)
Location 10:113642643-113642665
Sequence AGCATTCATCACTATGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074461535_1074461542 -8 Left 1074461535 10:113642628-113642650 CCAGGCCCCCTCACCAGCATTCA 0: 1
1: 0
2: 1
3: 34
4: 367
Right 1074461542 10:113642643-113642665 AGCATTCATCACTATGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074461542 Original CRISPR AGCATTCATCACTATGAGCT GGG Intronic
No off target data available for this crispr