ID: 1074463352

View in Genome Browser
Species Human (GRCh38)
Location 10:113659302-113659324
Sequence GGGGTATTATTGCATCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 72}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074463352 Original CRISPR GGGGTATTATTGCATCTGGT GGG (reversed) Intronic
907596090 1:55721274-55721296 GGAGTGCTATGGCATCTGGTGGG + Intergenic
910087853 1:83425262-83425284 TGGGAAATGTTGCATCTGGTTGG - Intergenic
911100962 1:94095536-94095558 CGGCTGTTATTGCAGCTGGTTGG - Intronic
922177865 1:223211134-223211156 GGGGTACTATTGCATCTTGTGGG - Intergenic
922177878 1:223211183-223211205 GAGGTACTATTGCATCTTGTGGG - Intergenic
922672649 1:227523090-227523112 GGGTTTTTTTTGCATTTGGTAGG + Intergenic
1068161725 10:53272967-53272989 GGGGTGTTATAGAATCTGTTTGG - Intergenic
1074463352 10:113659302-113659324 GGGGTATTATTGCATCTGGTGGG - Intronic
1075092940 10:119453605-119453627 GGCGTGTTGCTGCATCTGGTGGG - Intronic
1077517734 11:3012013-3012035 GTGGTACTAATGCACCTGGTGGG + Intronic
1080800046 11:35601980-35602002 CTGGTTTTATTGCATCTGGATGG - Intergenic
1088719320 11:112577932-112577954 TAGGTTTTATTGCATTTGGTAGG + Intergenic
1090471161 11:126982386-126982408 GGAGTCTTGATGCATCTGGTGGG + Intronic
1094358853 12:29608305-29608327 AGGGTATTATTGAATCTACTAGG - Intronic
1095502424 12:42855110-42855132 AGGATACTATTGCATATGGTAGG + Intergenic
1100428644 12:94510498-94510520 AGGGTATTAGTGTATTTGGTCGG - Intergenic
1101420077 12:104543617-104543639 GGGAAATTAATGCATTTGGTTGG + Intronic
1108468693 13:50745757-50745779 TGGGTATTTATGCCTCTGGTGGG + Intronic
1110770439 13:79337270-79337292 GAGGGATTCTTTCATCTGGTCGG - Exonic
1112377788 13:98860075-98860097 GGGATATTTTTGCAGGTGGTGGG - Intronic
1116529701 14:45954759-45954781 TGTGTATTTTTGCTTCTGGTAGG + Intergenic
1122814869 14:104307402-104307424 GGGGTATGAATGCCCCTGGTGGG + Intergenic
1123678722 15:22739982-22740004 GGGGTATTTATGAATCAGGTGGG + Intergenic
1124330928 15:28814265-28814287 GGGGTATTTATGAATCAGGTGGG + Intergenic
1125982023 15:44011076-44011098 GGGGTCTTGTTGCTTCTGCTTGG + Intronic
1127295005 15:57601630-57601652 GGGCTATCATTGCCTCTTGTGGG - Intronic
1131329293 15:91481694-91481716 AGTGTATTACTGCATCTGGGTGG - Intergenic
1131372458 15:91894247-91894269 GGGGTTTTATAGCATCTTGCAGG + Intronic
1135934521 16:26768386-26768408 GGGGAATTATTCCATCTGGGGGG - Intergenic
1140057364 16:71537100-71537122 GGGGGATGATTTCATCTTGTGGG - Exonic
1141179622 16:81743608-81743630 GGGCTTTTATTGGAACTGGTGGG + Intronic
1146500647 17:33361567-33361589 TGGGTATTATTACAACAGGTAGG - Intronic
1148777702 17:50104917-50104939 GGGGTGTTGTTGCATCCAGTGGG - Intronic
1150137861 17:62705414-62705436 GGGTTATTTTTGCCTCTGGGTGG + Intronic
1152389520 17:79994310-79994332 GGGGTTTCATTGCCTCTTGTCGG - Intronic
1158571696 18:58601972-58601994 GGGGTGCTACTGCATCTGGCGGG - Intronic
1163020302 19:14477971-14477993 AGGGCATTATTGCATTTGCTGGG + Exonic
926496288 2:13592614-13592636 GGGGTATTAGGCCCTCTGGTGGG + Intergenic
934935793 2:98464344-98464366 GTGGAATTATTGCACATGGTGGG + Intronic
940717545 2:157244848-157244870 GGGGTATTCTTCCATTAGGTGGG - Intergenic
942577629 2:177381366-177381388 GGATTATTATTGCTTGTGGTAGG + Intronic
946265878 2:218540935-218540957 GGGGTAATACTGTATGTGGTAGG - Intronic
1173159651 20:40643058-40643080 TGGGTCTTAAGGCATCTGGTTGG - Intergenic
1176666719 21:9694487-9694509 GGGGAATTAGTGTATCTGATGGG - Intergenic
1180238251 21:46478949-46478971 GGCTTACTTTTGCATCTGGTAGG + Intronic
952489339 3:33851399-33851421 GGGGTATTTATGAATCAGGTGGG + Intronic
954373493 3:50182550-50182572 GGGGTGTTCTTGCACCTGGCTGG + Intronic
956183790 3:66543899-66543921 GGAGTTTTATTCCTTCTGGTGGG + Intergenic
957983565 3:87543629-87543651 GGGGTTGGATTGCCTCTGGTGGG - Intergenic
959909188 3:111744098-111744120 GGGCTATTATTGCCTCTAGCTGG - Intronic
969510228 4:7613449-7613471 GGGGACTTATTGCTTCTGGGTGG - Intronic
974553360 4:63409964-63409986 GGGGCATTAATGCATTTGGGAGG + Intergenic
980900176 4:138897344-138897366 GGGGCATTATTACATCAGGTTGG - Intergenic
985408297 4:189657854-189657876 GGGGAATTAGTGTATCTGATGGG + Intergenic
996557193 5:124790637-124790659 GTGGTATTAGTGCTCCTGGTTGG + Intergenic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1000863618 5:166486231-166486253 AGGGTATTATTGCAACAGTTGGG - Intergenic
1003784355 6:9467605-9467627 TAGGAATTATTGAATCTGGTGGG - Intergenic
1007237059 6:40398205-40398227 GGTGTGTTCTGGCATCTGGTGGG - Intronic
1010166209 6:72917984-72918006 GGGGTGCTATTGCGTCTAGTGGG - Intronic
1011500787 6:87987157-87987179 GTGGTATTATTCCAGCTGTTTGG - Intergenic
1019620564 7:1989851-1989873 GGGCTATGAGTGGATCTGGTAGG - Intronic
1019675913 7:2312605-2312627 GAGGGATTGTTGCATTTGGTGGG - Intronic
1021185503 7:17559708-17559730 AGGTTATTTTTGCATGTGGTTGG - Intergenic
1022067233 7:26871798-26871820 GGTGTATTTTTGCATGTGGGAGG - Intronic
1022229142 7:28396380-28396402 GTGGTATTTTTGCACCTGTTGGG + Intronic
1027304732 7:76881736-76881758 TGGGAAATGTTGCATCTGGTTGG - Intergenic
1030164023 7:106534859-106534881 AGGATACTATTCCATCTGGTGGG + Intergenic
1033237801 7:139652028-139652050 GGTATATTATTGTATCTTGTAGG - Intronic
1034566295 7:151918282-151918304 GGGGTTTTATTGCATTTGTTTGG + Intergenic
1042354147 8:67807860-67807882 AGGGTATCATTGCTTCTGGAGGG - Intergenic
1042393126 8:68258851-68258873 GGGCTTTAATTGCATCTGGAAGG - Intergenic
1203659381 Un_KI270753v1:27274-27296 GGGGAATTAGTGTATCTGATGGG + Intergenic
1192048434 X:67700728-67700750 GGGGAATTATTTCATCTTGATGG + Intronic
1199558620 X:149137595-149137617 GACATATTATTGCATGTGGTGGG - Intergenic
1201300458 Y:12500287-12500309 TGGGTGTTCTCGCATCTGGTGGG - Intergenic
1202368564 Y:24182833-24182855 GGGGCATGAGTGCACCTGGTGGG + Intergenic
1202502221 Y:25487284-25487306 GGGGCATGAGTGCACCTGGTGGG - Intergenic