ID: 1074465719

View in Genome Browser
Species Human (GRCh38)
Location 10:113679742-113679764
Sequence CCGCACGCATAGTCCCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074465719_1074465729 13 Left 1074465719 10:113679742-113679764 CCCTCCAGGGACTATGCGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1074465729 10:113679778-113679800 TTTGGGCTCTTCCACCCCTGCGG 0: 1
1: 0
2: 5
3: 91
4: 803
1074465719_1074465728 -4 Left 1074465719 10:113679742-113679764 CCCTCCAGGGACTATGCGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1074465728 10:113679761-113679783 GCGGGGACACGGGTCGCTTTGGG 0: 1
1: 0
2: 0
3: 1
4: 31
1074465719_1074465727 -5 Left 1074465719 10:113679742-113679764 CCCTCCAGGGACTATGCGTGCGG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1074465727 10:113679760-113679782 TGCGGGGACACGGGTCGCTTTGG 0: 1
1: 0
2: 0
3: 1
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074465719 Original CRISPR CCGCACGCATAGTCCCTGGA GGG (reversed) Intronic
900151077 1:1179649-1179671 ACGCAGGGATGGTCCCTGGAGGG - Exonic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1073216594 10:101840037-101840059 CCGCCCCCAAAGTTCCTGGACGG + Intronic
1074465719 10:113679742-113679764 CCGCACGCATAGTCCCTGGAGGG - Intronic
1074476560 10:113779969-113779991 TCAAACACATAGTCCCTGGAAGG + Intronic
1084325522 11:68397604-68397626 CCGAGCGCACAGACCCTGGAGGG - Intronic
1094426652 12:30323173-30323195 TCTCACGCAGAATCCCTGGAAGG - Intergenic
1096102181 12:48976588-48976610 CCACACACATGGCCCCTGGAAGG - Intergenic
1102627464 12:114246913-114246935 CCTCACCCAAAGTCCCTTGAAGG - Intergenic
1114262221 14:21045205-21045227 CCGCAGGCAGAGTCCTGGGAGGG + Intronic
1128627271 15:69222403-69222425 CCCCTCGCATAGTCCCTGTCTGG - Intronic
1131158343 15:90088629-90088651 TCCCACGCCTAGTCCCTGGCTGG - Exonic
1146098388 17:29954657-29954679 CCCCACGCAGAGTCCCTGCTGGG + Intronic
1152130619 17:78474105-78474127 CTGCAGGCAGAGACCCTGGAGGG - Intronic
1152611790 17:81318516-81318538 CCGCATGCACAGTGCCTGGGAGG - Intronic
1160650519 19:223932-223954 CAGCACCCATAGTCCCGGCATGG - Intergenic
1162128701 19:8512603-8512625 CCGCCCACACAGTCCCTGGAAGG - Exonic
925298240 2:2792448-2792470 CCTCATGCCGAGTCCCTGGAAGG + Intergenic
928898793 2:36295712-36295734 CCTGACCCATAGTCCCAGGAAGG + Intergenic
938297500 2:130187546-130187568 CCCTACGCCTGGTCCCTGGAGGG - Intronic
938734622 2:134175075-134175097 CCGGACACATACTCCCTGGTAGG - Intronic
1178312182 21:31538880-31538902 CTGCACGCATCGTCCCTGCACGG + Intronic
1179035779 21:37757806-37757828 CCACACGCCTAGTCACTGGCTGG + Intronic
1181182002 22:21074940-21074962 CCCCAGGCCTGGTCCCTGGAGGG + Intergenic
1183678419 22:39312723-39312745 CCCCACCCTCAGTCCCTGGAGGG - Intergenic
953698459 3:45178310-45178332 CAGCTCGCACACTCCCTGGAGGG - Intergenic
964616612 3:158672979-158673001 CCGCATGCAGCGTCCCTGGCAGG + Intronic
966176065 3:177138878-177138900 CCTCACCCATACTCCCTAGAAGG + Intronic
997860026 5:137407910-137407932 CAGCAAGCATAGACCCTGCAGGG - Intronic
1002049900 5:176564813-176564835 GCCCACCCATAGTCTCTGGATGG + Intronic
1004781562 6:18914087-18914109 CCTGACTCATGGTCCCTGGAAGG - Intergenic
1018469645 6:164084068-164084090 CCCCACTCCTAGTCCTTGGATGG - Intergenic
1021380112 7:19956077-19956099 CTGCACCCATTTTCCCTGGATGG + Intergenic
1032128042 7:129208905-129208927 CCGGTCGCATAGCCCCAGGAGGG - Intronic
1053464691 9:38297159-38297181 CAGCTCTCATAGTCTCTGGATGG - Intergenic
1056680863 9:88716903-88716925 CTGAAAGCATATTCCCTGGAAGG + Intergenic
1186583764 X:10849659-10849681 CCTCACCCACAGTCCCTTGAGGG + Intergenic
1188443093 X:30231844-30231866 CCCCTCCCATAGTCCCTAGAGGG - Intronic
1188443395 X:30233581-30233603 CCCCTCCCATAGTCCCTAGAGGG - Intronic
1200952614 Y:8915124-8915146 CAGTACGCATAGTCTCTAGATGG - Intergenic
1201388875 Y:13474725-13474747 CTGCACCTATAGTCCCAGGATGG - Intronic