ID: 1074470632

View in Genome Browser
Species Human (GRCh38)
Location 10:113723414-113723436
Sequence CCAGCTCCTGCTGTTTCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074470628_1074470632 -2 Left 1074470628 10:113723393-113723415 CCTGAAAGGCAGATTATGATACC 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1074470632 10:113723414-113723436 CCAGCTCCTGCTGTTTCTTGGGG No data
1074470626_1074470632 15 Left 1074470626 10:113723376-113723398 CCTGATTTTTTTGCTTTCCTGAA 0: 1
1: 0
2: 2
3: 63
4: 660
Right 1074470632 10:113723414-113723436 CCAGCTCCTGCTGTTTCTTGGGG No data
1074470625_1074470632 24 Left 1074470625 10:113723367-113723389 CCACATCATCCTGATTTTTTTGC 0: 1
1: 0
2: 2
3: 39
4: 468
Right 1074470632 10:113723414-113723436 CCAGCTCCTGCTGTTTCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074470632 Original CRISPR CCAGCTCCTGCTGTTTCTTG GGG Intronic
No off target data available for this crispr