ID: 1074473085

View in Genome Browser
Species Human (GRCh38)
Location 10:113744814-113744836
Sequence CTGTCTGCAGAGGTGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074473085_1074473092 30 Left 1074473085 10:113744814-113744836 CCTGCCTCCACCTCTGCAGACAG No data
Right 1074473092 10:113744867-113744889 TTGAGCATGCTGTTTCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074473085 Original CRISPR CTGTCTGCAGAGGTGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr