ID: 1074479937

View in Genome Browser
Species Human (GRCh38)
Location 10:113810028-113810050
Sequence AGGTATCTGGAGTACATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074479932_1074479937 0 Left 1074479932 10:113810005-113810027 CCTGGCTCTCCTACGACTAAAGA No data
Right 1074479937 10:113810028-113810050 AGGTATCTGGAGTACATGGCAGG No data
1074479931_1074479937 11 Left 1074479931 10:113809994-113810016 CCATCTGGGAACCTGGCTCTCCT No data
Right 1074479937 10:113810028-113810050 AGGTATCTGGAGTACATGGCAGG No data
1074479934_1074479937 -9 Left 1074479934 10:113810014-113810036 CCTACGACTAAAGAAGGTATCTG No data
Right 1074479937 10:113810028-113810050 AGGTATCTGGAGTACATGGCAGG No data
1074479929_1074479937 18 Left 1074479929 10:113809987-113810009 CCATTTTCCATCTGGGAACCTGG No data
Right 1074479937 10:113810028-113810050 AGGTATCTGGAGTACATGGCAGG No data
1074479928_1074479937 19 Left 1074479928 10:113809986-113810008 CCCATTTTCCATCTGGGAACCTG No data
Right 1074479937 10:113810028-113810050 AGGTATCTGGAGTACATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074479937 Original CRISPR AGGTATCTGGAGTACATGGC AGG Intergenic
No off target data available for this crispr